View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19163_high_48 (Length: 240)
Name: NF19163_high_48
Description: NF19163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19163_high_48 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 34505773 - 34505553
Alignment:
| Q |
1 |
tactgattatcaggtcttccaaatttttggcaatcaaactgagcttcaacgaaaggacaggttgaagaatcatagagaggatatgaagagtcaatcaccc |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34505773 |
tactgattatcaggtcttccaaattgttggcaatcaaactgagcttcaacgaaaggacagcttgaagaatcatagagaggatatgaagagtcaatcaccc |
34505674 |
T |
|
| Q |
101 |
agcttccaaagaacaaattacaattatttgacttttgtgctgttgctgggtgcatggatacaagtagagctatgctaaacagtgagagcaaaaacaatgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
34505673 |
agcttccaaagaacaaattacaattatttgacttttgtgctgttgctgggtgcatggatacaagtagagctatgctaaacagagagagcaaaaacaatgt |
34505574 |
T |
|
| Q |
201 |
atggacattgaaagccatatg |
221 |
Q |
| |
|
||||||||| ||||||||||| |
|
|
| T |
34505573 |
atggacattcaaagccatatg |
34505553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 1 - 125
Target Start/End: Complemental strand, 34515607 - 34515483
Alignment:
| Q |
1 |
tactgattatcaggtcttccaaatttttggcaatcaaactgagcttcaacgaaaggacaggttgaagaatcatagagaggatatgaagagtcaatcaccc |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| |||||||| | ||| || ||| |||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
34515607 |
tactgattatcaagtcttccaaatttttggcaatcaaattgagcttctaagaaggggcagcttgaagaatcatagagagtatatgaagagccaatcaccc |
34515508 |
T |
|
| Q |
101 |
agcttccaaagaacaaattacaatt |
125 |
Q |
| |
|
| || ||| |||||||||||||||| |
|
|
| T |
34515507 |
aactaccagagaacaaattacaatt |
34515483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 149 - 220
Target Start/End: Complemental strand, 34515423 - 34515352
Alignment:
| Q |
149 |
ggtgcatggatacaagtagagctatgctaaacagtgagagcaaaaacaatgtatggacattgaaagccatat |
220 |
Q |
| |
|
|||||||||||||||| ||||||| |||||| | ||||| ||||||||| |||||||||||||| |||||| |
|
|
| T |
34515423 |
ggtgcatggatacaaggagagctaggctaaagaaagagaggaaaaacaatttatggacattgaaacccatat |
34515352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 67 - 119
Target Start/End: Original strand, 4690721 - 4690773
Alignment:
| Q |
67 |
gaatcatagagaggatatgaagagtcaatcacccagcttccaaagaacaaatt |
119 |
Q |
| |
|
||||||||||||||||| |||| ||||| |||||| ||||| | ||||||||| |
|
|
| T |
4690721 |
gaatcatagagaggataagaagggtcaaccacccaacttcctatgaacaaatt |
4690773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University