View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19163_high_60 (Length: 205)
Name: NF19163_high_60
Description: NF19163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19163_high_60 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 17 - 188
Target Start/End: Original strand, 28686604 - 28686775
Alignment:
| Q |
17 |
gaagaggatagagtgtatggactacctgggcagcctccagtgaatttcaaacaatatgctgggtacataaatgttaatgaaactcatggaagagcactgt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28686604 |
gaagaggatagagtgtatggactacctgggcagcctccagtgaatttcaaacaatatgctgggtacataaatgttaatgaaactcatggaagagcactgt |
28686703 |
T |
 |
| Q |
117 |
tttattggttttttgagtctgttgatcaacctcaaacaaaacctcttctcctttggcttaatggaggtattt |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28686704 |
tttattggttttttgagtctgttgatcaacctcaaacaaaacctcttctcctttggcttaatggaggtattt |
28686775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000007; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 60 - 133
Target Start/End: Original strand, 3338496 - 3338569
Alignment:
| Q |
60 |
atttcaaacaatatgctgggtacataaatgttaatgaaactcatggaagagcactgttttattggttttttgag |
133 |
Q |
| |
|
|||||||||| |||||||| || | | ||| |||||||| |||||||| |||| |||||||||||||||||| |
|
|
| T |
3338496 |
atttcaaacactatgctggttatgtcattgtcaatgaaaccaatggaagatcactcttttattggttttttgag |
3338569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 89 - 133
Target Start/End: Original strand, 3332178 - 3332222
Alignment:
| Q |
89 |
gttaatgaaactcatggaagagcactgttttattggttttttgag |
133 |
Q |
| |
|
||||||||||| ||||||||||| ||||||| |||||||||||| |
|
|
| T |
3332178 |
gttaatgaaaccaatggaagagcattgttttactggttttttgag |
3332222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University