View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19163_low_19 (Length: 372)
Name: NF19163_low_19
Description: NF19163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19163_low_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 30 - 360
Target Start/End: Complemental strand, 9742274 - 9741944
Alignment:
| Q |
30 |
ggaagctaagggggagcattatgctaatagatgcagcaccctttaaccccattttgcaaacaaatatgctcaaatgatgtattgtaaggcttgcttgtgg |
129 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
9742274 |
ggaagctaagggggagcattatgctgatagatgcagcaccctttaaccccattttgcaaacaaatatcctcaaatgatgtattgtaaggcttgcttgtgg |
9742175 |
T |
 |
| Q |
130 |
tagatgaatatatttggagttctgtggcaatatttataggcagaagagttttggtttttacttgattaattatttttgagtaagttaactcctctctcta |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9742174 |
tagatgaatatatttggagttctgtggcaatatttataggcaaaagagttttggtttttacttgattaattatttttgagtaagttaactcct--ctcta |
9742077 |
T |
 |
| Q |
230 |
tcaattctattaattcattttgcctaataaattagttatgagttttgactttcaattgcagctatacttgtacttgtatgttgcatactttgtagatcta |
329 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9742076 |
tcaattctattaattcattttgcctaattaattagttatgagttttgactttcaattgcagctatacttgtacttgtatgttgcatactttgtagatcta |
9741977 |
T |
 |
| Q |
330 |
tcccag--taatatgtacgagatcatatttctg |
360 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| |
|
|
| T |
9741976 |
tcccagtctaatatgtacgagatcatatttctg |
9741944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University