View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19163_low_21 (Length: 363)
Name: NF19163_low_21
Description: NF19163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19163_low_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 310; Significance: 1e-174; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 15 - 353
Target Start/End: Complemental strand, 5713709 - 5713369
Alignment:
| Q |
15 |
atgaacaagagctctgtcaatgtctatgatctgttcccaaccacaa--gcagtcaaattcggcagatttttgggtggtgatgggtcgtcctcgtccagcc |
112 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
5713709 |
atgaacaagagctatgtcaatgtctatgatctgttcccaaccacaaaagcagtcaaattcgacagatttttgagtggtgatgggtcgtcctcgtccagcc |
5713610 |
T |
|
| Q |
113 |
tgcatgagacccaccttttcaagctttttactggctcttcgacattgatgataccgcttgtgtagtgcctaacaatgcttccattacaccgcagaaaacg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5713609 |
tgcatgagacccaccttttcaagcttttcactggctcttcgacattgatgataccgcttgtgtagtgcctaacaatgcttccattacaccgcagaaaacg |
5713510 |
T |
|
| Q |
213 |
acacatctctactttccctagcataatgatgagaccattagtgacactttttgcatgtatctctatcattgactgatcaacttctttgtatctcttccat |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5713509 |
acacatctctactttccctagcataatgatgagaccattagtgacactttttgcatgtatctctatcattgactgatcaacttctttgtatctcttccat |
5713410 |
T |
|
| Q |
313 |
gcccatagtaatgtttctccttttcctaggcatcccctttg |
353 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5713409 |
gcccatattaatgtttctccttttcctaggcatcccctttg |
5713369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University