View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19163_low_29 (Length: 310)
Name: NF19163_low_29
Description: NF19163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19163_low_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 16 - 287
Target Start/End: Complemental strand, 35991277 - 35991006
Alignment:
| Q |
16 |
catcatcatatcagcaaacttgatcaatgttacatatgatttaaataacagaatattgaaacactgtttctttaccgcgatacatggagcaaacacgtat |
115 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
35991277 |
catcaacatatcagcaaacttgatcaatgttacatatgatttaaataacagaatattgaaacactgtttctttaccgcgatacatggagcaaacacatat |
35991178 |
T |
 |
| Q |
116 |
ggaattccagtagctctaacttcaagggcagttgcttctccaatcttttttattagcactggatccctaataaacagtagattccattacaataaaagca |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35991177 |
ggaattccagtagctctaacttcaagggcagttgcttctccaatcttttttattagcactggatccctaataaacagtagattccattacaataaaagca |
35991078 |
T |
 |
| Q |
216 |
agaaaatgcactaaattgcaaggtttgtttttatcgcaaaggttcacttcttcaagtatagcttccagttac |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35991077 |
agaaaatgcactaaattgcaaggtttgtttttatcgcaaaggttcacttcttcaagtatagcttccagttac |
35991006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 113 - 162
Target Start/End: Complemental strand, 9990311 - 9990262
Alignment:
| Q |
113 |
tatggaattccagtagctctaacttcaagggcagttgcttctccaatctt |
162 |
Q |
| |
|
|||||||||||||| |||||| ||||||| |||||||| || |||||||| |
|
|
| T |
9990311 |
tatggaattccagttgctctagcttcaagagcagttgcatcaccaatctt |
9990262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 87 - 159
Target Start/End: Complemental strand, 10011889 - 10011817
Alignment:
| Q |
87 |
ttaccgcgatacatggagcaaacacgtatggaattccagtagctctaacttcaagggcagttgcttctccaat |
159 |
Q |
| |
|
|||||||||| || || || || || ||||||||||| || |||||| ||||||| ||||||||||| ||||| |
|
|
| T |
10011889 |
ttaccgcgatgcaaggcgcgaagacatatggaattcccgttgctctagcttcaagagcagttgcttcaccaat |
10011817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University