View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19163_low_37 (Length: 259)
Name: NF19163_low_37
Description: NF19163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19163_low_37 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 1 - 252
Target Start/End: Complemental strand, 2372491 - 2372240
Alignment:
| Q |
1 |
ccaccattgacatcaaaagaaaagcttttgaagtgattcggcgatcgaaaaggactaatatcttcaagaccttccattaattcccatgtgttgattgttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2372491 |
ccaccattgacatcaaaagaaaagcttttgaagtgattcggcgatcgaaaaggactaatatcttcaagaccttccattaattcccatgtgttgattgttt |
2372392 |
T |
 |
| Q |
101 |
ctggttcaccaggtggtgttcttgttggtgtcttaggaacaacttttgttaacttttcttcaatcatattagaccaagtttttgcctcaatcaaccccat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2372391 |
ctggttcaccaggtggtgttcttgttggtgtcttaggaacaacttttgttaacttttcttcaatcatgttagaccaagtttttgcctcaatcaaccccat |
2372292 |
T |
 |
| Q |
201 |
tgaaaattctttcactttctcatcactttccaatgcttcttccttcttctct |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2372291 |
tgaaaattctttcactttctcatcactttccaatgcttcttccttcttctct |
2372240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 5 - 95
Target Start/End: Complemental strand, 3376967 - 3376877
Alignment:
| Q |
5 |
cattgacatcaaaagaaaagcttttgaagtgattcggcgatcgaaaaggactaatatcttcaagaccttccattaattcccatgtgttgat |
95 |
Q |
| |
|
|||| ||||||||||| || ||| | || ||||| || ||| |||||||||| |||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
3376967 |
cattaacatcaaaagagaaacttcttaattgatttggtgattgaaaaggacttgtatcttcaagtccttccattagttcccatgtgttgat |
3376877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University