View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19163_low_54 (Length: 237)

Name: NF19163_low_54
Description: NF19163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19163_low_54
NF19163_low_54
[»] chr1 (2 HSPs)
chr1 (5-101)||(43841497-43841593)
chr1 (142-204)||(43841603-43841665)


Alignment Details
Target: chr1 (Bit Score: 97; Significance: 8e-48; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 5 - 101
Target Start/End: Original strand, 43841497 - 43841593
Alignment:
5 attggagtactatagcatggtaattcctaaacttaatctatttatgttgataaaatatgaattaacgcatcaacgtaagcataacttagttttatta 101  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43841497 attggagtactatagcatggtaattcctaaacttaatctatttatgttgataaaatatgaattaacgcatcaacgtaagcataacttagttttatta 43841593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 142 - 204
Target Start/End: Original strand, 43841603 - 43841665
Alignment:
142 tacgtaagcataacttagttaataaggaattgcaatatagagagattttaattcgaattatag 204  Q
    ||||||||||||| |||||||||||||| ||||||||||||||||||| ||||||||||||||    
43841603 tacgtaagcataatttagttaataaggacttgcaatatagagagatttgaattcgaattatag 43841665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University