View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19163_low_56 (Length: 236)
Name: NF19163_low_56
Description: NF19163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19163_low_56 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 41 - 194
Target Start/End: Complemental strand, 29552007 - 29551860
Alignment:
| Q |
41 |
caacaagaacaaaaataaagtctaagtactagtgcatgacatgtaacatctaccaaacttgagtgccttgcattgctcaacaattaatacaatttgaaga |
140 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29552007 |
caacaagaacaaaaataaagtctaagt------gcatgacatgtaacatctaccaaacttgagtgccttgcattgctcaaaaattaatacaatttgaaga |
29551914 |
T |
|
| Q |
141 |
tgacaattggtagacaaacttaacagaacaatggtttggtacatattagtataa |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29551913 |
tgacaattggtagacaaacttaacagaacaatggtttggtacatattagtataa |
29551860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University