View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19163_low_59 (Length: 220)
Name: NF19163_low_59
Description: NF19163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19163_low_59 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 18 - 204
Target Start/End: Complemental strand, 6990271 - 6990089
Alignment:
| Q |
18 |
gattcatttgtgtgttcgcatccaacttgaagttatgttcaattgcacacgcagatttttgcactattttcattggtgttaaattagctttagacaaggg |
117 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6990271 |
gattcatttgtgtgtttgcatccaacttgaagttatgttcaattgcacacgcagatttttgcgctatttttattggtgttaaattagctttagacaaggg |
6990172 |
T |
 |
| Q |
118 |
ctgccaaagaattcttgtcgagtctgactctcaagttgccgtgggtttactaaatagtggaggcccttcttctcactcacttctctg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
6990171 |
ctgccaaagaattcttgtcgagtctgactctcaagttgccgtgggtttactaaatagtggag----ctcttctcactcacttctctg |
6990089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University