View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19165_high_20 (Length: 256)
Name: NF19165_high_20
Description: NF19165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19165_high_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 139; Significance: 8e-73; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 93 - 239
Target Start/End: Complemental strand, 10251778 - 10251632
Alignment:
| Q |
93 |
atcaagttgacctctgtgatggtttgaggaattcaggacttcaaacattcttaatacaagtttcttccatatggatttgaatcataaacaaatttcaaat |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
10251778 |
atcaagttgacctctgtgatggtttgaggaattcaggacttcaaacattcttaatacaagtttcttccatttggatttgaatcataaacaaatttcaaat |
10251679 |
T |
 |
| Q |
193 |
gaattaagtttagtctaaatagtttggtgatagagaagcacgtttct |
239 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10251678 |
gaattgagtttagtctaaatagtttggtgatagagaagcacgtttct |
10251632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 15 - 51
Target Start/End: Complemental strand, 10251856 - 10251820
Alignment:
| Q |
15 |
agacaaaaacaataaaatcttacattgcaccaaacaa |
51 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10251856 |
agacaaaaacaataaaatcttacattgcaccaaacaa |
10251820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University