View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19165_low_18 (Length: 289)
Name: NF19165_low_18
Description: NF19165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19165_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 160; Significance: 3e-85; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 107 - 278
Target Start/End: Complemental strand, 29291295 - 29291124
Alignment:
| Q |
107 |
tgccattgtggaatacatgcaggaaactgataatgatctgtctaaaagaatgcttaggttacttccaaaatgtattcaggtacactaaaattatgcaaac |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29291295 |
tgccattgtggaatacatgcaggaaactgataatgatctgtctaaaagaatgcttaggttacttccaaaatgtattcaggtacactaaaattatgcaaac |
29291196 |
T |
 |
| Q |
207 |
tatatatttgtcttatgttttgatcctattcttctcatacaaataacacatatttgcagacctctggccttt |
278 |
Q |
| |
|
|||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
29291195 |
tatatacttgtgttatgttttgatcctattcttctcatacaaataacacatatttgcagatctctggccttt |
29291124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 1 - 105
Target Start/End: Complemental strand, 29291440 - 29291336
Alignment:
| Q |
1 |
ctcaattacagaaggtgtaagtgaccaacaggatataatagaactaacacagctcatcatcccatctctaattcaagccctagagaaggtatttgatcat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29291440 |
ctcaattacagaaggtgtaagtgaccaacaggatataatagaactaacacaactcatcatcccatctctaattcaagccctagagaaggtatttgatcat |
29291341 |
T |
 |
| Q |
101 |
tgttc |
105 |
Q |
| |
|
||||| |
|
|
| T |
29291340 |
tgttc |
29291336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University