View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19165_low_24 (Length: 229)
Name: NF19165_low_24
Description: NF19165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19165_low_24 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 55; Significance: 9e-23; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 14 - 131
Target Start/End: Original strand, 1948301 - 1948418
Alignment:
| Q |
14 |
aagaaaataattagctatatgtttgcatctactatattgatccttcnnnnnnnnnnnnnnnnnnnnncagtacttatctcatttagctaatcacataaac |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1948301 |
aagaaaataattagctatatgtttgcatctactatattgatccttcaaacaaaaacaaattaaaaaacagtacttatctcatttagctaatcacataaac |
1948400 |
T |
|
| Q |
114 |
aaggcattttgtatgtaa |
131 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
1948401 |
aaggcattttgtatgtaa |
1948418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University