View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19165_low_28 (Length: 207)

Name: NF19165_low_28
Description: NF19165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19165_low_28
NF19165_low_28
[»] chr3 (1 HSPs)
chr3 (6-190)||(38827902-38828086)
[»] chr2 (2 HSPs)
chr2 (34-150)||(43851744-43851860)
chr2 (75-139)||(41383014-41383078)
[»] chr7 (1 HSPs)
chr7 (75-154)||(14199139-14199218)
[»] chr8 (1 HSPs)
chr8 (39-175)||(34408878-34409014)
[»] chr6 (1 HSPs)
chr6 (78-139)||(7980033-7980094)


Alignment Details
Target: chr3 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 6 - 190
Target Start/End: Complemental strand, 38828086 - 38827902
Alignment:
6 gatgtcgaagaatatcaagctgatgccaaacaaaaggccattgatgattggcttcctgtaactgcttctagaaatgccaaatggtggtattcagcgttcc 105  Q
    ||||| ||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
38828086 gatgtagaaaaaaatcaagctgatgccaaacaaaaggccattgatgattggcttcctgtaactgcttctagaaatgccaaatggtggtattcggcgttcc 38827987  T
106 acaatctaacagccatggttggtgctggtgttctcagtcttccatatgcaatgtcccatatgggatggtatgaatacattctagt 190  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38827986 acaatctaacagccatggttggtgctggtgttctcagtcttccatatgcaatgtcccatatgggatggtatgaatacattctagt 38827902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 34 - 150
Target Start/End: Original strand, 43851744 - 43851860
Alignment:
34 aacaaaaggccattgatgattggcttcctgtaactgcttctagaaatgccaaatggtggtattcagcgttccacaatctaacagccatggttggtgctgg 133  Q
    |||||||||| || ||||||||||||||  ||||| |||| || ||||| |||||||||||  |||| || |||||| | || ||||||||||| |||||    
43851744 aacaaaaggcaatagatgattggcttcccataacttcttcaaggaatgcaaaatggtggtacgcagcttttcacaatgttactgccatggttggagctgg 43851843  T
134 tgttctcagtcttccat 150  Q
    |||  | ||||||||||    
43851844 tgtcttgagtcttccat 43851860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 75 - 139
Target Start/End: Complemental strand, 41383078 - 41383014
Alignment:
75 agaaatgccaaatggtggtattcagcgttccacaatctaacagccatggttggtgctggtgttct 139  Q
    |||||||| ||||||||||| ||  | ||||||||| | || ||||||||||| |||||||||||    
41383078 agaaatgcaaaatggtggtactctactttccacaatgtcactgccatggttggagctggtgttct 41383014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 40; Significance: 0.00000000000007; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 75 - 154
Target Start/End: Complemental strand, 14199218 - 14199139
Alignment:
75 agaaatgccaaatggtggtattcagcgttccacaatctaacagccatggttggtgctggtgttctcagtcttccatatgc 154  Q
    |||||||| |||||||||||||| || ||||||||| | || ||||||||||| ||||||||||| ||||| || |||||    
14199218 agaaatgcaaaatggtggtattctgcattccacaatgttactgccatggttggagctggtgttcttagtctcccttatgc 14199139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 39 - 175
Target Start/End: Original strand, 34408878 - 34409014
Alignment:
39 aaggccattgatgattggcttcctgtaactgcttctagaaatgccaaatggtggtattcagcgttccacaatctaacagccatggttggtgctggtgttc 138  Q
    |||||||| |||||||||||||| || ||||| || || || |||||||||||||| || || || |||||| | || ||||||||||| || || ||||    
34408878 aaggccatcgatgattggcttcccgtcactgcctcgaggaaagccaaatggtggtactctgcttttcacaatatcacggccatggttggcgccggcgttc 34408977  T
139 tcagtcttccatatgcaatgtcccatatgggatggta 175  Q
    |||  ||||| || || |||||  | |||||||||||    
34408978 tcacccttccttacgccatgtctaagatgggatggta 34409014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 78 - 139
Target Start/End: Complemental strand, 7980094 - 7980033
Alignment:
78 aatgccaaatggtggtattcagcgttccacaatctaacagccatggttggtgctggtgttct 139  Q
    ||||| ||||||||||| ||||| || |||||| | || ||||||||||| |||||||||||    
7980094 aatgcaaaatggtggtactcagcttttcacaatgtcactgccatggttggagctggtgttct 7980033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University