View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19167_high_13 (Length: 374)
Name: NF19167_high_13
Description: NF19167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19167_high_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 119; Significance: 1e-60; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 177 - 356
Target Start/End: Complemental strand, 25544331 - 25544152
Alignment:
| Q |
177 |
caataatggtgtcaccattattttggaaattgaagcggtttttaacattgaatagtttcaacattgaactaatcaatgttnnnnnnncttttcaacctcc |
276 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||| |||||||||||||||||||| |||||||||||| |||||||| | |||||||||| |
|
|
| T |
25544331 |
caataatggagtcaccattattttggaaatggaagcgttttttaacattgaatagtttaaacattgaactattcaatgttaaaaaaacgattcaacctcc |
25544232 |
T |
 |
| Q |
277 |
acaataatgacaccattattgctcattccgcggccgagagcttgaaacacagacacatctttgagatatgaagctagaca |
356 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
25544231 |
acaataatgacaccattattgctcattcggcggccgagagcttgaaacacagacgcatcttcgagatatgaagctagaca |
25544152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University