View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19167_low_20 (Length: 272)
Name: NF19167_low_20
Description: NF19167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19167_low_20 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 4 - 254
Target Start/End: Complemental strand, 12538730 - 12538478
Alignment:
| Q |
4 |
cgagtgagatgaatacctttaggcatgatagtaactctc--agcatgaatagcacagaaacaaaccaacgaggtaagctccagtggctttttggagagcg |
101 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12538730 |
cgagtgagttgaatacctttaggcatgatagtaactctcttagcatgaatagcacagaaacaaaccaacgaggtaagctccagtggctttttggagagcg |
12538631 |
T |
|
| Q |
102 |
gaaacacacttgttttttatacctcgtactccatactatccactctatatttcaaggcggggcagataatcggtttaagacgatttgttgatattcaatt |
201 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12538630 |
gaaacacacttgttttttatacctcgtgctccatactatccactctatatttcaaggcggggcagataatcggtttaagacgatttgttgatattcaatt |
12538531 |
T |
|
| Q |
202 |
taaacatataagtgagaaagaaccatgaggttgtccattttaatcatgggttc |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
12538530 |
taaacatataagtgagaaagaaccatgaggttctccattttaatcatgggttc |
12538478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University