View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19167_low_24 (Length: 252)
Name: NF19167_low_24
Description: NF19167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19167_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 240
Target Start/End: Original strand, 45109428 - 45109650
Alignment:
| Q |
18 |
tattgtataatttggtgtattgattattggtcttggtaatagatgggaagcaaagttgaggagtgtatctttgagacttgcttacataggaaacatatgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45109428 |
tattgtataatttggtgtattgattattggtcttggtaatagatgggaagcaaagttgaggagtgtatctttgagacttgcttacataggaaacatatgt |
45109527 |
T |
 |
| Q |
118 |
ttggcatttttgttctttccagtcacaagaatgtcttctattctgcctcttgttggactcacatctgagtcaagcatcaagtatcatatctggcttggac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45109528 |
ttggcatttttgttctttccagtcacaagaatgtcttctattctgcctcttgttggactcacatctgagtcaagcatcaagtatcatatctggcttggac |
45109627 |
T |
 |
| Q |
218 |
atttatctatggttctctctgct |
240 |
Q |
| |
|
| |||||||||||||||| |||| |
|
|
| T |
45109628 |
aattatctatggttctctttgct |
45109650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 57 - 233
Target Start/End: Original strand, 45126663 - 45126839
Alignment:
| Q |
57 |
tagatgggaagcaaagttgaggagtgtatctttgagacttgcttacataggaaacatatgtttggcatttttgttctttccagtcacaagaatgtcttct |
156 |
Q |
| |
|
|||||||||||| ||||| |||||||||| ||||||||| | |||||||||||||||||||| |||||||||||||||||| || |||||| |||||| |
|
|
| T |
45126663 |
tagatgggaagcgaagttcaggagtgtatttttgagactaggttacataggaaacatatgttgggcatttttgttctttccggttacaagagggtcttcc |
45126762 |
T |
 |
| Q |
157 |
attctgcctcttgttggactcacatctgagtcaagcatcaagtatcatatctggcttggacatttatctatggttct |
233 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
45126763 |
attctgcgtcttgttggactcacatctgagtcaagcatcaaatatcatatctggcttggacaattatctatggttct |
45126839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University