View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19168_high_10 (Length: 408)
Name: NF19168_high_10
Description: NF19168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19168_high_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 314; Significance: 1e-177; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 1 - 393
Target Start/End: Complemental strand, 18018324 - 18017932
Alignment:
| Q |
1 |
tttcctcccttttcaaacgaggtcttgtctaccccttagggccggtcttgggcaataggctgggagtgcgatggcccaggtcctcaaggagcccgggtaa |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||| | || |||||| |||||||| ||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
18018324 |
tttcctctcttttcaaacgaggtcttgtctaccccttagggctgatcctgggca-taggctggaagtgcgatggcccaggtcctcaaggggcctaggtaa |
18018226 |
T |
 |
| Q |
101 |
tacccctttgatttgtgcccaagagaatataagatgctcaaagttgatcttgttttaacacaaatatctctcaaactaaattcaatcgtaaaggcaaaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| || |
|
|
| T |
18018225 |
tacccctttgatttgtgcccaagagaatataacatgctcaaagttgatcttgttttaacacaaatatctctcaaattaaattcaatcgtaaaggcaagca |
18018126 |
T |
 |
| Q |
201 |
acacagtttaaagtattgcatttt-ataaccaacaaattgttgaacttccaatagattcttgaggatttgtgtttaaaattacatgcaaattttagtcat |
299 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18018125 |
acacagtttaaagtattgcatttttataatcaacaaattgttgaacttccaatagattcttgaggatttgtgtttaaaattacatgcaaattttagtcat |
18018026 |
T |
 |
| Q |
300 |
caactttgtttaaagtgttgttctatttagccatcgacacaactctctcggcatcttcttcgaacaacttgaattaaattggatgttgatactg |
393 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18018025 |
caacattgtttaaagtgttgttctatttggccatcggcacaactctctcgacatcttcttcgaacaacttgaattaaattggatgttgatactg |
18017932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University