View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19168_high_27 (Length: 273)
Name: NF19168_high_27
Description: NF19168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19168_high_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 96 - 256
Target Start/End: Original strand, 36789277 - 36789440
Alignment:
| Q |
96 |
ttgtgacctatctatctaatttaactcagttcgactgag--taggttggtaatgcgtgatttgttctgttgtttggaggacatgaaaccagaagtttggc |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36789277 |
ttgtgacctatctatctaatttaactcagttcgactgagagtaggttggtaatgcatgatttgttctgttgtttggaggacatgaaaccagaagtttggc |
36789376 |
T |
 |
| Q |
194 |
ttcttcttc-ttatctcattcgtcattcgtggcatttggtgtttcctctatctacacgtgtatt |
256 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36789377 |
ttcttcttctttatctcagtcgtcattcgtggcatttggtgtttcctctatctacacgtgtatt |
36789440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 29
Target Start/End: Original strand, 36789188 - 36789216
Alignment:
| Q |
1 |
cacttgattgttttacaagtaagaaatgg |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
36789188 |
cacttgattgttttacaagtaagaaatgg |
36789216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University