View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19168_high_28 (Length: 263)
Name: NF19168_high_28
Description: NF19168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19168_high_28 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 4 - 251
Target Start/End: Complemental strand, 2427746 - 2427496
Alignment:
| Q |
4 |
ctccttcaaattcctttgttttatggcgcttaatgcataataagttacctactgatgaaaacttataatta---catggttgaactttggtgttggtatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | || |||||||||||||||||||||||||| |
|
|
| T |
2427746 |
ctccttcaaattcctttgttttatggcgcttaatgcataataagttacctactgatgaaaacttacgaatatttcatggttgaactttggtgttggtatg |
2427647 |
T |
 |
| Q |
101 |
tgtgttatgcatgctcactgatgagacttcccctcaaatgatgtttatgcatcctttcagcatgcatctttggttatggttgggtgggaagataaattgt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2427646 |
tgtgttatgcatgctcactgatgagacttcccctcgaatgatctttatgcatcctttcaccatgcatctttggttatggttgggtgggaagataaattgt |
2427547 |
T |
 |
| Q |
201 |
tcgattgacacatcttccttcgaggggttgttggcttgtgtcctaacacag |
251 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
2427546 |
tcgattgacacatcctccttcgaggggttgttggcttgcgtcctaacacag |
2427496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University