View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19168_low_17 (Length: 360)
Name: NF19168_low_17
Description: NF19168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19168_low_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 281; Significance: 1e-157; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 13 - 342
Target Start/End: Complemental strand, 31837878 - 31837549
Alignment:
| Q |
13 |
aatatcaaggatcacaactaaaattgttgtcacatagtttcaacaataataatggatttggagacctccacaattgcaccatgagtccatgactgcaatt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31837878 |
aatatcaaggatcacaactaaaattgttgtcacatagtttcaacaataataatggatttggagacctccacaattgcaccatgagtccatgactgcaatt |
31837779 |
T |
 |
| Q |
113 |
gcggccacatcggttgcatttgacagtannnnnnncnnnnnnnntctaggatcacgattcacagctacaaatgttgtcctggttttgaagtgcagtttac |
212 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31837778 |
gcggccacatcggttgcatttgacagtatttttttcaaaaaaaatctaggatcacgattcacagctacaaatgttgtcctggttttgaagtgcagtttac |
31837679 |
T |
 |
| Q |
213 |
aatataaatcttcagtggccttcacaactgcatcaggactgcaattgcagccacatcgatcgcgtttgaccgtgctttttcacgatatcaagaatcacaa |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
31837678 |
aatataaatcttcagtggccttcacaactgcatcaggactgcaattgcagccacatcgatcgcatttgaccgtgctttttcacgatatcaagaatcacaa |
31837579 |
T |
 |
| Q |
313 |
caaaatcaaccacagattgaaggcgtttag |
342 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
31837578 |
caaaatcaaccacagattgaaggcgtttag |
31837549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 250 - 323
Target Start/End: Original strand, 26265427 - 26265500
Alignment:
| Q |
250 |
actgcaattgcagccacatcgatcgcgtttgaccgtgctttttcacgatatcaagaatcacaacaaaatcaacc |
323 |
Q |
| |
|
||||||||||||| ||||||||||| ||| ||||| |||| || | |||||||||||||||||| || ||||| |
|
|
| T |
26265427 |
actgcaattgcagacacatcgatcgtgttagaccgaactttatcccaatatcaagaatcacaacataagcaacc |
26265500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University