View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19168_low_24 (Length: 287)
Name: NF19168_low_24
Description: NF19168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19168_low_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 17 - 276
Target Start/End: Original strand, 39917306 - 39917565
Alignment:
| Q |
17 |
atatagcttatcctcgtcaaatcaacttggaactttcattggctataccctctccctctcaacagcaacagccacaagctttgtgtctttgtcgtcaaat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39917306 |
atatagcttatcctcgtcaaatcaacttggaactttcattggctataccctctccctctcaacagcaacagccacaagctttgtgtctttgtcgtcaaat |
39917405 |
T |
 |
| Q |
117 |
atctttagggttatatggtagtagccaccaaccttgttgctgcaataataccatacctatcgttggtgtttcaacttctactgctccactacctgctacc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39917406 |
atctttagggttatatggtagtagccaccaaccttgttgctgcaataataccatacctatcgttggtgtttcaacttctactgctccactacctgctacc |
39917505 |
T |
 |
| Q |
217 |
accgtcgccgggaatggttttttcaaattttctggaaccgggattgtcaacaagttttga |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39917506 |
accgtcgccgggaatggttttttcaaattttctggaaccgggattgtcaacaagttttga |
39917565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University