View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19168_low_26 (Length: 278)
Name: NF19168_low_26
Description: NF19168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19168_low_26 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 29 - 146
Target Start/End: Original strand, 12471691 - 12471808
Alignment:
| Q |
29 |
tgttttgcatgagatttatgtatatattcattattaggggtctaggtaggaggattgtggaagttgagaaggaatcgaattttgcaaagaggcaagggta |
128 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||||||||||||| |||||||||||||| ||| ||| ||||| |||||| | ||| | ||||||||| |
|
|
| T |
12471691 |
tgttttgcatgagatttacgtatatattgtttattaggggtctagggaggaggattgtggatgttaagatggaattgaatttggaaaacaagcaagggta |
12471790 |
T |
|
| Q |
129 |
cctcgaaggttaagggta |
146 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
12471791 |
cctcgaaggttaagggta |
12471808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 159 - 227
Target Start/End: Original strand, 12471849 - 12471917
Alignment:
| Q |
159 |
tcttttctaagggtggttgcttgttgttattggcatttgtaccagatttcgaatacaaatgaaaataaa |
227 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||| |||||| |||| |||||||||||||| |
|
|
| T |
12471849 |
tcttttctaagggaggttgcttgttgttattggcatttgtactagattttgaatccaaatgaaaataaa |
12471917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.0000000001; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 62 - 116
Target Start/End: Complemental strand, 4708537 - 4708483
Alignment:
| Q |
62 |
ttaggggtctaggtaggaggattgtggaagttgagaaggaatcgaattttgcaaa |
116 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
4708537 |
ttaggggtctagggaggagaattgtggaagttgagatggaattgaatttggcaaa |
4708483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 178 - 228
Target Start/End: Complemental strand, 4707763 - 4707713
Alignment:
| Q |
178 |
cttgttgttattggcatttgtaccagatttcgaatacaaatgaaaataaat |
228 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||| ||||||||||||||| |
|
|
| T |
4707763 |
cttgttgttattggcatttgtacttgattttgaacccaaatgaaaataaat |
4707713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 29 - 144
Target Start/End: Complemental strand, 20503870 - 20503754
Alignment:
| Q |
29 |
tgttttgcatgagatttatgtatatattcattattaggggtctag-gtaggaggattgtggaagttgagaaggaatcgaattttgcaaagaggc-aaggg |
126 |
Q |
| |
|
|||||||||| ||||||||||||| || ||||| ||||||| | |||| |||||||||||||| |||| ||||| ||| || |||||||||| ||||| |
|
|
| T |
20503870 |
tgttttgcattcgatttatgtatatgttatttattcggggtctggagtag-aggattgtggaagtcgagatggaatagaaattggcaaagaggcaaaggg |
20503772 |
T |
|
| Q |
127 |
tacctcgaaggttaaggg |
144 |
Q |
| |
|
|| || ||||||||||| |
|
|
| T |
20503771 |
taacttaaaggttaaggg |
20503754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University