View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19168_low_27 (Length: 276)
Name: NF19168_low_27
Description: NF19168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19168_low_27 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 262
Target Start/End: Complemental strand, 2427987 - 2427726
Alignment:
| Q |
1 |
acttatttgcttttgtctgtgctggttatgggccattggaacctccctgttgctattatgaatcaatcggttgttgtagcgaatattgttcagttaacgc |
100 |
Q |
| |
|
|||||||||||| |||| |||||||||||| ||||||| ||||||| |||||||||||||||||| | ||||||||||||||||||||||||||||| | |
|
|
| T |
2427987 |
acttatttgcttctgtccatgctggttatggaccattgggacctccccgttgctattatgaatcaaccagttgttgtagcgaatattgttcagttaacac |
2427888 |
T |
 |
| Q |
101 |
tatcagtctcctcttttcttaataagtgtgtttggttgcattctctagacggcaaaaccacaaccaaacaactgtttagatttgttaatcatgtttcttt |
200 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| | |||||||||||||||||| |
|
|
| T |
2427887 |
tatcagtctcctcttttcttgataagtgtgtttggttgcattctctagacggcaaaaccacaaccaagcaactgtttagctatgttaatcatgtttcttt |
2427788 |
T |
 |
| Q |
201 |
atctcttgcttgggatattaatatttggcggccttgtatttctccttcaaattcctttgttt |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2427787 |
atctcttgcttgggatattaatatttggcggccttgtattcctccttcaaattcctttgttt |
2427726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University