View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19168_low_30 (Length: 252)
Name: NF19168_low_30
Description: NF19168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19168_low_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 19 - 237
Target Start/End: Complemental strand, 21724861 - 21724643
Alignment:
| Q |
19 |
catggcctacgagatctttaagtataaaattgatgtcattttgaagaccttggttgaggaaatggaggtttatactccattttcatgacacactttgttt |
118 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21724861 |
catggcctacgagatctttaagtgtaaaattgatgtcattttgaagaccttggttgaggaaaaggaggtttatactccattttcatgacacactttgttt |
21724762 |
T |
 |
| Q |
119 |
tttgttcatggatttgttgttctccttcttggaacctgaccgttctcaaagtctgttactggttgggtacttcaacaaggtatatgattgatagtcggaa |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
21724761 |
tttgttcatggatttgttgttctccttcttggaacctgaccgttctcaaagtccgttactggttgggtacttcaacaaggtatatgtttgacagtcggaa |
21724662 |
T |
 |
| Q |
219 |
ctttttgtttttatgacat |
237 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
21724661 |
ctttttgtttttatgacat |
21724643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University