View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19168_low_31 (Length: 250)
Name: NF19168_low_31
Description: NF19168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19168_low_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 12 - 249
Target Start/End: Original strand, 56468728 - 56468965
Alignment:
| Q |
12 |
atgaagtcgtgccttgtcaagattcccacaattggaggtctctgcataacaaccacaaatattagtaattgttagttaatactcactcccagccaacaaa |
111 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
56468728 |
atgaagtcgtgccttgtcaagatccccacaattggaggtctctgcataacaaccacaaatattagtaattgttagttaatactcactcccagccaacata |
56468827 |
T |
 |
| Q |
112 |
caaggataattgtaattaatgattgcaaagtcagccaatgtatacttaaatacatggatatgtttattcaagattgtaatagtatattgtttcttactcc |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56468828 |
caaggataattgtaattaatgattgcaaagtcagccaatgtatacttaaatgcatggatatgtttattcaagattgtaatagtatattgtttcttactcc |
56468927 |
T |
 |
| Q |
212 |
ggatgtctttggcaccaccaacaaatgcctgaggccaa |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56468928 |
ggatgtctttggcaccaccaacaaatgcctgaggccaa |
56468965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University