View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19169_high_10 (Length: 244)
Name: NF19169_high_10
Description: NF19169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19169_high_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 2413169 - 2413403
Alignment:
| Q |
1 |
atagacgccgcagcaagtgcagcagcggtgtcagcgtcaacatcagaaccaggattctttgaagatacgtaataaacagttctaacagtgtccatatctt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| ||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2413169 |
atagacgccgcagcaagtgcagcagcggtttcagcggcaacatcagaaccgggattctttgaagatacgaaataaacagttctaacagtgtccatatctt |
2413268 |
T |
 |
| Q |
101 |
ctggtctttcccaacatttgtgatcaacatttggatctccaacaccaacatagagtcttccaggtgttgatgttgcacatttgaggagataatctgtcgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2413269 |
ctggtctttcccaacatttgtgatcaacatttggatctccaacaccaacatagagtcttccaggtgttgatgttgcacatttgaggagataatctgtcgc |
2413368 |
T |
 |
| Q |
201 |
gtggcgaattgcagctcttgcttctttcatctgtg |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
2413369 |
gtggcgaattgcagctcttgcttctttcatttgtg |
2413403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University