View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19169_high_3 (Length: 403)
Name: NF19169_high_3
Description: NF19169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19169_high_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 359; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 359; E-Value: 0
Query Start/End: Original strand, 13 - 387
Target Start/End: Complemental strand, 2412819 - 2412445
Alignment:
| Q |
13 |
cagatcacacattcacaaaataaattttaaacatacggtcgaaatcactaactgtgtgacacagtttttggaggcaacctatttcttaccattagagaga |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
2412819 |
cagatcacacattcacaaaataaattttaaacatacggtcgaaatcactaactgtgtgacacagtttttggaggcaacctatttcttactattagagaga |
2412720 |
T |
 |
| Q |
113 |
attgatgtgattctactagtgctgttctaataggcattatttatcttcaggatgaactattgtggggagctgcatggctttttagagcaacaaatgctgc |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2412719 |
attgatgtgattctactagtgctgttctaataggcattatttatcttcaggatgaactattgtggggagctgcatggctttttagagcaacaaatgctgt |
2412620 |
T |
 |
| Q |
213 |
taaatactacaatttggttaagtctttgggagctgatgatcaacctgatatcttcagctgggataacaagtatgctggtgcacatgtccttctctcaagg |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2412619 |
taaatactacaatttggttaagtctttgggagctgatgatcaacctgatatcttcagctgggataacaaatatgctggtgcacatgtccttctctcaagg |
2412520 |
T |
 |
| Q |
313 |
gtaagttggatttcattgaaaatgtgaataaccaatttgtttctctaaactttgctgattcattagttttctatt |
387 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2412519 |
gtaagttggatttcattgaaaatgtgaataaccaatttgtttgtctaaactttgctgattcattagttttctatt |
2412445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University