View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19169_high_6 (Length: 303)
Name: NF19169_high_6
Description: NF19169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19169_high_6 |
 |  |
|
| [»] scaffold0018 (1 HSPs) |
 |  |  |
|
| [»] scaffold0608 (1 HSPs) |
 |  |
|
| [»] scaffold0445 (1 HSPs) |
 |  |
|
| [»] scaffold0707 (1 HSPs) |
 |  |
|
| [»] scaffold0128 (1 HSPs) |
 |  |
|
| [»] scaffold0121 (2 HSPs) |
 |  |
|
| [»] scaffold0088 (1 HSPs) |
 |  |
|
| [»] scaffold0024 (1 HSPs) |
 |  |
|
| [»] scaffold0009 (1 HSPs) |
 |  |
|
| [»] scaffold1185 (1 HSPs) |
 |  |
|
| [»] scaffold0366 (1 HSPs) |
 |  |
|
| [»] scaffold0179 (1 HSPs) |
 |  |  |
|
| [»] scaffold0014 (1 HSPs) |
 |  |
|
| [»] scaffold1787 (1 HSPs) |
 |  |
|
| [»] scaffold0460 (2 HSPs) |
 |  |
|
| [»] scaffold0275 (1 HSPs) |
 |  |
|
| [»] scaffold0100 (1 HSPs) |
 |  |  |
|
| [»] scaffold0031 (1 HSPs) |
 |  |  |
|
| [»] scaffold0028 (1 HSPs) |
 |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |
|
| [»] scaffold0288 (1 HSPs) |
 |  |
|
| [»] scaffold0690 (1 HSPs) |
 |  |
|
| [»] scaffold0025 (1 HSPs) |
 |  |  |
|
| [»] scaffold0157 (1 HSPs) |
 |  |
|
| [»] scaffold0038 (2 HSPs) |
 |  |
|
| [»] scaffold1372 (1 HSPs) |
 |  |
|
| [»] scaffold0864 (1 HSPs) |
 |  |
|
| [»] scaffold0294 (1 HSPs) |
 |  |
|
| [»] scaffold0187 (2 HSPs) |
 |  |
|
| [»] scaffold0113 (1 HSPs) |
 |  |
|
| [»] scaffold0085 (1 HSPs) |
 |  |
|
| [»] scaffold0010 (1 HSPs) |
 |  |  |
|
| [»] scaffold0003 (1 HSPs) |
 |  |
|
| [»] scaffold0330 (1 HSPs) |
 |  |  |
|
| [»] scaffold1709 (1 HSPs) |
 |  |
|
| [»] scaffold1331 (1 HSPs) |
 |  |
|
| [»] scaffold0394 (1 HSPs) |
 |  |
|
| [»] scaffold0254 (1 HSPs) |
 |  |
|
| [»] scaffold0063 (1 HSPs) |
 |  |
|
| [»] scaffold0045 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 140; Significance: 2e-73; HSPs: 148)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 184
Target Start/End: Original strand, 36725284 - 36725462
Alignment:
| Q |
1 |
tatttgacaactcaagagaacttttggtatggtatgagtagaagtgagggaggggaactcaatttataggtgaagaaccaaagataagttacaaatccaa |
100 |
Q |
| |
|
||||||||||||||| |||||||||||| || |||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36725284 |
tatttgacaactcaaaagaacttttggtgtg-----agtagaagtgagggaggggagctcaatttataggtgaagagccaaagataagttacaaatccaa |
36725378 |
T |
 |
| Q |
101 |
tggctaggattagttgaccgttagaaaatcaatggcttgatctctcatcataaatgagcactaattgagaaagttgacaagaga |
184 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36725379 |
tggctaggattaattgaccgttagaaaatcaatggcttgatctcgcatcataaatgagcactaattgagaaagttgacaagaga |
36725462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 3 - 184
Target Start/End: Complemental strand, 33380445 - 33380269
Alignment:
| Q |
3 |
tttgacaactcaagagaacttttggtatggtatgagtagaagtgagggaggggaactcaatttataggtgaagaaccaaagataagttacaaatccaatg |
102 |
Q |
| |
|
||||||||||||| |||||||||||| || |||||||||| ||||| || ||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
33380445 |
tttgacaactcaaaagaacttttggtgtg-----agtagaagtgggggagaagagctcaatttataggtgaagagccaaagataagttacaaattcaatg |
33380351 |
T |
 |
| Q |
103 |
gctaggattagttgaccgttagaaaatcaatggcttgatctctcatcataaatgagcactaattgagaaagttgacaagaga |
184 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
33380350 |
actaggattagttcaccgttagaaaatcaatggcttgatctcacatcataaatgagcactaattgagaaaattgacatgaga |
33380269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 3 - 179
Target Start/End: Original strand, 12906720 - 12906891
Alignment:
| Q |
3 |
tttgacaactcaagagaacttttggtatggtatgagtagaagtgagggaggggaactcaatttataggtgaagaaccaaagataagttacaaatccaatg |
102 |
Q |
| |
|
||||||||||||||| |||||||||| || |||||||||||||||| ||| ||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
12906720 |
tttgacaactcaagataacttttggtttg-----agtagaagtgagggagaggagctcaatttataggtgaagagtcaaagataagttacaaatccaatg |
12906814 |
T |
 |
| Q |
103 |
gctaggattagttgaccgttagaaaatcaatggcttgatctctcatcataaatgagcactaattgagaaagttgaca |
179 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||| |||| |||||||||||| |||||||| |||||||||||| |
|
|
| T |
12906815 |
gttaggattagttgaccgttagaaaatcaatggctttatcttacatcataaatgaacactaattaagaaagttgaca |
12906891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 196 - 303
Target Start/End: Original strand, 36726498 - 36726605
Alignment:
| Q |
196 |
aattcacaccataacactccatgtgttccaacagtttgtaaataagtaagtaatagtttcatccccgtgagcttagctcagttgatagggatattgcata |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||| |||||| ||| |
|
|
| T |
36726498 |
aattcacaccataacactccatgtgttccaacagtttgtaaataagtaagtaatagtttcattcccgtgagtttagctcagttgataggaatattgtata |
36726597 |
T |
 |
| Q |
296 |
ttatatgc |
303 |
Q |
| |
|
|||||||| |
|
|
| T |
36726598 |
ttatatgc |
36726605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 7 - 101
Target Start/End: Complemental strand, 19309122 - 19309033
Alignment:
| Q |
7 |
acaactcaagagaacttttggtatggtatgagtagaagtgagggaggggaactcaatttataggtgaagaaccaaagataagttacaaatccaat |
101 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
19309122 |
acaactcaagagaacttttgg---ggta--agtagaagtgagggagaggagctcaatttataggtgaagaaccaaagataagttacaaattcaat |
19309033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 2 - 179
Target Start/End: Complemental strand, 24159332 - 24159160
Alignment:
| Q |
2 |
atttgacaactcaagagaacttttggtatggtatgagtagaagtgagggaggggaactcaatttataggtgaagaaccaaagataagttacaaatccaat |
101 |
Q |
| |
|
|||||||||||||||||||||||||| ||| |||||||| || ||||| || || ||||||||||||||| ||||||| ||||| ||||||||| |
|
|
| T |
24159332 |
atttgacaactcaagagaacttttgg---ggt--gagtagaaatgtgggagaagagctttatttataggtgaagagtcaaagatgagttataaatccaat |
24159238 |
T |
 |
| Q |
102 |
ggctaggattagttgaccgttagaaaatcaatggcttgatctctcatcataaatgagcactaattgagaaagttgaca |
179 |
Q |
| |
|
|||||||||||||||||| || |||||||||| | | || |||| | ||||||||||||| | || || |||||||| |
|
|
| T |
24159237 |
ggctaggattagttgacctctacaaaatcaatgacataatttctccttataaatgagcactcaatgggacagttgaca |
24159160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 86 - 184
Target Start/End: Complemental strand, 19309010 - 19308912
Alignment:
| Q |
86 |
aagttacaaatccaatggctaggattagttgaccgttagaaaatcaatggcttgatctctcatcataaatgagcactaattgagaaagttgacaagaga |
184 |
Q |
| |
|
||||||||||| ||| |||| ||||||||||| ||||||||||||||| || ||||||| ||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
19309010 |
aagttacaaattcaacagctatgattagttgactgttagaaaatcaatgattttatctctcctcataaatgagtactaattgagaaagttgacatgaga |
19308912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 3 - 184
Target Start/End: Original strand, 31064534 - 31064710
Alignment:
| Q |
3 |
tttgacaactcaagagaacttttggtatggtatgagtagaagtgagggaggggaactcaatttataggtgaagaaccaaagataagttacaaatccaatg |
102 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||| |||||||||| | || || |||||||||||| ||||||||||| |||| | |||||||| |
|
|
| T |
31064534 |
tttgacaactcaagagaacttttg---tggt--gagaagaagtgaggaacaagagctatatttataggtgaggaaccaaagatgagttttagatccaatg |
31064628 |
T |
 |
| Q |
103 |
gctaggattagttgaccgttagaaaatcaatggcttgatctctcatcataaatgagcactaattgagaaagttgacaagaga |
184 |
Q |
| |
|
|||| ||| | |||||||||| ||||| ||||| |||| ||| | | ||||||||||| ||||||| |||||||||| |||| |
|
|
| T |
31064629 |
gctacgatcatttgaccgttacaaaataaatggtttgacctcacctaataaatgagcaataattgataaagttgacatgaga |
31064710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 35 - 184
Target Start/End: Complemental strand, 23191511 - 23191362
Alignment:
| Q |
35 |
tgagtagaagtgagggaggggaactcaatttataggtgaagaaccaaagataagttacaaatccaatggctaggattagttgaccgttagaaaatcaatg |
134 |
Q |
| |
|
|||| |||||||||| | | || ||| |||||||||||| || ||||||||||||||||||||||||| ||||||||||||||| | |||||||||| |
|
|
| T |
23191511 |
tgagaagaagtgaggaaagagagctctatttataggtgaggagtcaaagataagttacaaatccaatggttaggattagttgaccaccacaaaatcaatg |
23191412 |
T |
 |
| Q |
135 |
gcttgatctctcatcataaatgagcactaattgagaaagttgacaagaga |
184 |
Q |
| |
|
| |||| | | ||||||||||| ||| | ||||| |||||||| |||| |
|
|
| T |
23191411 |
acatgatattgcttcataaatgagaactcaatgagatagttgacatgaga |
23191362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 35 - 184
Target Start/End: Complemental strand, 28857550 - 28857401
Alignment:
| Q |
35 |
tgagtagaagtgagggaggggaactcaatttataggtgaagaaccaaagataagttacaaatccaatggctaggattagttgaccgttagaaaatcaatg |
134 |
Q |
| |
|
||||||||||||||| | || ||| |||||||||||| || |||||||| |||| | |||||||||||| ||| | ||||| |||| ||||| |||| |
|
|
| T |
28857550 |
tgagtagaagtgaggaacaagagctctatttataggtgaggagccaaagatgagttttagatccaatggctaagatcatttgacagttacaaaattaatg |
28857451 |
T |
 |
| Q |
135 |
gcttgatctctcatcataaatgagcactaattgagaaagttgacaagaga |
184 |
Q |
| |
|
|||| ||| | ||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
28857450 |
atttgacctcacctcataaatgagcaataattgagaaagttgacatgaga |
28857401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 253 - 303
Target Start/End: Complemental strand, 52426989 - 52426939
Alignment:
| Q |
253 |
ttcatccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52426989 |
ttcatctccgtgagcttagctcagttgatagggatattgcatattatatgc |
52426939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 255 - 303
Target Start/End: Original strand, 3269615 - 3269663
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3269615 |
catccccgtgagcttagctcagttggtagggatattgcatattatatgc |
3269663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 255 - 303
Target Start/End: Complemental strand, 4482672 - 4482624
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4482672 |
catccccgtgagcttagctcagttggtagggatattgcatattatatgc |
4482624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 255 - 303
Target Start/End: Original strand, 6702572 - 6702620
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6702572 |
catccccgtgagcttagctcagttggtagggatattgcatattatatgc |
6702620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 255 - 303
Target Start/End: Original strand, 8865850 - 8865898
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8865850 |
catccccgtgagcttagctcagttggtagggatattgcatattatatgc |
8865898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 255 - 303
Target Start/End: Complemental strand, 15819675 - 15819627
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
15819675 |
catccccgtgagcttagctcagttggtagggatattgcatattatatgc |
15819627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 1570265 - 1570218
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1570265 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
1570218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 2352638 - 2352591
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2352638 |
atccccgtgagcttagctcagttgatagagatattgcatattatatgc |
2352591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 3 - 162
Target Start/End: Complemental strand, 2493338 - 2493184
Alignment:
| Q |
3 |
tttgacaactcaagagaacttttggtatggtatgagtagaagtgagggaggggaactcaatttataggtgaagaaccaaagataagttacaaatccaatg |
102 |
Q |
| |
|
||||||||||||| |||||||||||| || | |||||||||| | | || ||| |||||||||||| || ||||||||||||||||||| ||||| |
|
|
| T |
2493338 |
tttgacaactcaaaagaacttttggtgtgatc-----agaagtgaggaatgagagctctatttataggtgaggagccaaagataagttacaaattcaatg |
2493244 |
T |
 |
| Q |
103 |
gctaggattagttgaccgttagaaaatcaatggcttgatctctcatcataaatgagcact |
162 |
Q |
| |
|
| |||||||||||| || | |||||||||| | |||| | | ||||||||||||||| |
|
|
| T |
2493243 |
gttaggattagttggccaccacaaaatcaatgacatgatattgcctcataaatgagcact |
2493184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 6438137 - 6438090
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6438137 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
6438090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 7166300 - 7166253
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7166300 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
7166253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 10664867 - 10664820
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10664867 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
10664820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 21265653 - 21265700
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
21265653 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
21265700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 22563383 - 22563430
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
22563383 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
22563430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 25999847 - 25999894
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25999847 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
25999894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 26584819 - 26584772
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26584819 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
26584772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 32594248 - 32594295
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32594248 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
32594295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 33207202 - 33207249
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33207202 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
33207249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 33254725 - 33254772
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33254725 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
33254772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 33274897 - 33274944
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33274897 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
33274944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 35605696 - 35605649
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35605696 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
35605649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 40519617 - 40519570
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40519617 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
40519570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 42490483 - 42490436
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42490483 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
42490436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 46965737 - 46965784
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
46965737 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
46965784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 50899583 - 50899536
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
50899583 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
50899536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 256 - 302
Target Start/End: Original strand, 42054330 - 42054376
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
42054330 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
42054376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 256 - 301
Target Start/End: Original strand, 1151756 - 1151801
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1151756 |
atccccgtgagcttagctcagttggtagggatattgcatattatat |
1151801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 258 - 303
Target Start/End: Original strand, 16343027 - 16343072
Alignment:
| Q |
258 |
ccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16343027 |
ccccgtgagcttagctcagttggtagggatattgcatattatatgc |
16343072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 259 - 303
Target Start/End: Complemental strand, 9866254 - 9866210
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9866254 |
cccgtgagcttagctcagttggtagggatattgcatattatatgc |
9866210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 255 - 303
Target Start/End: Original strand, 11065116 - 11065164
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
11065116 |
catccccgtgagcttagctcagatgatagagatattgcatattatatgc |
11065164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 255 - 303
Target Start/End: Complemental strand, 18551707 - 18551659
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
18551707 |
catccccgtgagcttagctcagttggtatggatattgcatattatatgc |
18551659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 263 - 303
Target Start/End: Complemental strand, 42848797 - 42848757
Alignment:
| Q |
263 |
tgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42848797 |
tgagcttagctcagttgatagggatattgcatattatatgc |
42848757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 1836500 - 1836547
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
1836500 |
atccccgtgagcttagctcagttggtagggatattacatattatatgc |
1836547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 260 - 303
Target Start/End: Original strand, 2277755 - 2277798
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2277755 |
ccgtgagcttagctcagttggtagggatattgcatattatatgc |
2277798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 2556553 - 2556600
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2556553 |
atccccgtaagcttagctcagttggtagggatattgcatattatatgc |
2556600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 2754357 - 2754404
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
2754357 |
atccccgtgagcttagcttagttggtagggatattgcatattatatgc |
2754404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 6130106 - 6130059
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6130106 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgc |
6130059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 6893310 - 6893263
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
6893310 |
atccccgtgagcttagctcagttggtagggatattgcattttatatgc |
6893263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 260 - 303
Target Start/End: Original strand, 7191033 - 7191076
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7191033 |
ccgtgaccttagctcagttgatagggatattgcatattatatgc |
7191076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 260 - 303
Target Start/End: Original strand, 11215002 - 11215045
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11215002 |
ccgtgagcttagctcagttggtagggatattgcatattatatgc |
11215045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 13773165 - 13773212
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
13773165 |
atccccgtgagtttagctcagttggtagggatattgcatattatatgc |
13773212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 16526250 - 16526203
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
16526250 |
atccccgtgagcttagctcaattggtagggatattgcatattatatgc |
16526203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 18467271 - 18467224
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18467271 |
atccccgtgagcatagctcagttggtagggatattgcatattatatgc |
18467224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 260 - 303
Target Start/End: Original strand, 34058215 - 34058258
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34058215 |
ccgtgagcttagctcagttggtagggatattgcatattatatgc |
34058258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 37662630 - 37662583
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37662630 |
atcctcgtgagcttagctcagttggtagggatattgcatattatatgc |
37662583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 40375388 - 40375341
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40375388 |
atccccgtgagcatagctcagttggtagggatattgcatattatatgc |
40375341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 40520827 - 40520874
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40520827 |
atccccgtgagtttagctcagttggtagggatattgcatattatatgc |
40520874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 43884791 - 43884838
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43884791 |
atccccgtgagtttagctcagttggtagggatattgcatattatatgc |
43884838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 260 - 303
Target Start/End: Original strand, 44019277 - 44019320
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
44019277 |
ccgtgagcttagctcagttgatagggatattgcattttatatgc |
44019320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 44732630 - 44732677
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
44732630 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgc |
44732677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 47402736 - 47402689
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
47402736 |
atccccgtgagcttagctcagctggtagggatattgcatattatatgc |
47402689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 48638529 - 48638576
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
48638529 |
atccccgtgagcttagctcagttggtagggatattgcattttatatgc |
48638576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 51050187 - 51050234
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
51050187 |
atccccgtgagcttagctcagttggtagggatattgtatattatatgc |
51050234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 79 - 165
Target Start/End: Original strand, 32987862 - 32987948
Alignment:
| Q |
79 |
caaagataagttacaaatccaatggctaggattagttgaccgttagaaaatcaatggcttgatctctcatcataaatgagcactaat |
165 |
Q |
| |
|
|||| ||| ||||||||| ||| | ||| |||||||| ||||||| ||||||||||| |||||||| | |||||||||| ||||||| |
|
|
| T |
32987862 |
caaatatacgttacaaattcaaagactaagattagttaaccgttacaaaatcaatggtttgatctcacctcataaatgaacactaat |
32987948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 254 - 303
Target Start/End: Original strand, 8415724 - 8415773
Alignment:
| Q |
254 |
tcatccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||| |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8415724 |
tcatccacgtgagcttagctcagttcgtagggatattgcatattatatgc |
8415773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 255 - 303
Target Start/End: Complemental strand, 12502328 - 12502280
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||| ||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
12502328 |
catccccgtaagcatagctcagttggtagggatattgcatattatatgc |
12502280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 259 - 303
Target Start/End: Complemental strand, 32556999 - 32556955
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
32556999 |
cccgtgagcttagctcagctggtagggatattgcatattatatgc |
32556955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 254 - 302
Target Start/End: Complemental strand, 47478923 - 47478875
Alignment:
| Q |
254 |
tcatccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||| |||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
47478923 |
tcatcctcgtgagcttaactcagttggtagggatattgcatattatatg |
47478875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 7180687 - 7180640
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| |||||||||||| |||| |||||||||||||||||| |
|
|
| T |
7180687 |
atccccgtgaggttagctcagttggtaggaatattgcatattatatgc |
7180640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 18216903 - 18216950
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||| ||||| |
|
|
| T |
18216903 |
atccccgtgagcttagctcagttggtagggatattacatattttatgc |
18216950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 260 - 303
Target Start/End: Original strand, 19011356 - 19011399
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
19011356 |
ccgtgagcttagctcaattggtagggatattgcatattatatgc |
19011399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 23545527 - 23545480
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||| |||| ||||| ||||||||||||||||||||||| |
|
|
| T |
23545527 |
atccccgtgagctaagcttagttggtagggatattgcatattatatgc |
23545480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 109 - 184
Target Start/End: Complemental strand, 25659694 - 25659619
Alignment:
| Q |
109 |
attagttgaccgttagaaaatcaatggcttgatctctcatcataaatgagcactaattgagaaagttgacaagaga |
184 |
Q |
| |
|
|||||||||||| || |||||||||| | ||||||||| | ||||||||||||| | ||||| |||||||| |||| |
|
|
| T |
25659694 |
attagttgaccgctacaaaatcaatgacatgatctctcctaataaatgagcactcaatgagatagttgacatgaga |
25659619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 26550491 - 26550538
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||| ||||||| |
|
|
| T |
26550491 |
atccccgtgagcttaactcagttggtagggatattgcatactatatgc |
26550538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 258 - 301
Target Start/End: Original strand, 27818568 - 27818611
Alignment:
| Q |
258 |
ccccgtgagcttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
27818568 |
ccccctgagcttagctcagttggtagggatattgcatattatat |
27818611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 29188633 - 29188680
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29188633 |
atccccgtgattttagctcagttggtagggatattgcatattatatgc |
29188680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 252 - 303
Target Start/End: Complemental strand, 32970877 - 32970826
Alignment:
| Q |
252 |
tttcatccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||| ||||||| ||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
32970877 |
tttcttccccgtaagcgtagctcagttgatagggatattgcattttatatgc |
32970826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 260 - 302
Target Start/End: Original strand, 18534002 - 18534044
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
18534002 |
ccgtgagcttagctcagttggtagagatattgcatattatatg |
18534044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 261 - 303
Target Start/End: Complemental strand, 42299581 - 42299539
Alignment:
| Q |
261 |
cgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
42299581 |
cgtgagcttagttcagttggtagggatattgcatattatatgc |
42299539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 256 - 302
Target Start/End: Complemental strand, 48607822 - 48607776
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
48607822 |
atccccgtgagtttaactcagttgatagggatattgcattttatatg |
48607776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 261 - 303
Target Start/End: Original strand, 52369599 - 52369641
Alignment:
| Q |
261 |
cgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
52369599 |
cgtgagtttagctcagttggtagggatattgcatattatatgc |
52369641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 254 - 303
Target Start/End: Original strand, 34271839 - 34271888
Alignment:
| Q |
254 |
tcatccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||| ||||||||| || |||||||||| |||||||||||| |
|
|
| T |
34271839 |
tcatccccgtgagtttagctcagctggtagggatattacatattatatgc |
34271888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 262 - 303
Target Start/End: Original strand, 46225390 - 46225431
Alignment:
| Q |
262 |
gtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
46225390 |
gtgagcttagctcagttggtagggatattgcattttatatgc |
46225431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 262 - 302
Target Start/End: Complemental strand, 3694982 - 3694942
Alignment:
| Q |
262 |
gtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3694982 |
gtgagcttagctcagttggaagggatattgcatattatatg |
3694942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 255 - 303
Target Start/End: Complemental strand, 4553620 - 4553572
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||| |||||||| ||| |||||||||||||||||| |
|
|
| T |
4553620 |
catccccgtgagcttaactcagttggtagaaatattgcatattatatgc |
4553572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 251 - 303
Target Start/End: Complemental strand, 5190859 - 5190807
Alignment:
| Q |
251 |
gtttcatccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||| |||||| ||||||||||||| ||| ||||||||| ||||||||||||| |
|
|
| T |
5190859 |
gtttaatccccatgagcttagctcaattggtagggatatcgcatattatatgc |
5190807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 260 - 303
Target Start/End: Original strand, 12662688 - 12662732
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgata-gggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
12662688 |
ccgtgagcttagctcagttaataagggatattgcatattatatgc |
12662732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 14760822 - 14760777
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
14760822 |
atccccgtgagcttagctcagttggta--gatattgcatattatatgc |
14760777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 259 - 303
Target Start/End: Original strand, 15390220 - 15390264
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||| |||| |
|
|
| T |
15390220 |
cccgtgagcttaactcagttggtagggatattgcatattagatgc |
15390264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 259 - 303
Target Start/End: Original strand, 15775739 - 15775783
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||||||||||||||||| |
|
|
| T |
15775739 |
cccgtgagcttaactcaattggtagggatattgcatattatatgc |
15775783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 259 - 295
Target Start/End: Original strand, 24874138 - 24874174
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcata |
295 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |
|
|
| T |
24874138 |
cccgtgagcttagctcagttgatagggacattgcata |
24874174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 259 - 295
Target Start/End: Original strand, 24874971 - 24875007
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcata |
295 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
24874971 |
cccgtgagcttagctcagttggtagggatattgcata |
24875007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 259 - 295
Target Start/End: Complemental strand, 31401315 - 31401279
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcata |
295 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |
|
|
| T |
31401315 |
cccgtgagcttagctcagttgatagggacattgcata |
31401279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 196 - 228
Target Start/End: Complemental strand, 33379881 - 33379849
Alignment:
| Q |
196 |
aattcacaccataacactccatgtgttccaaca |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
33379881 |
aattcacaccataacactccatgtgttccaaca |
33379849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 259 - 303
Target Start/End: Complemental strand, 34656465 - 34656421
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||| |||||||| |
|
|
| T |
34656465 |
cccgtgagtttagctcagttgatagagatattgcattttatatgc |
34656421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 259 - 303
Target Start/End: Original strand, 42366863 - 42366907
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
42366863 |
cccgtaagcttagctgagttgatagggatattgcattttatatgc |
42366907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 256 - 296
Target Start/End: Complemental strand, 45333784 - 45333744
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatat |
296 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45333784 |
atccccgtgagcttagctcagttggcagggatattgcatat |
45333744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 303
Target Start/End: Complemental strand, 46161189 - 46161149
Alignment:
| Q |
263 |
tgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
46161189 |
tgagcttagctcagttggtaggaatattgcatattatatgc |
46161149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 303
Target Start/End: Original strand, 51933510 - 51933550
Alignment:
| Q |
263 |
tgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
51933510 |
tgagcttagctcaattggtagggatattgcatattatatgc |
51933550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 6463109 - 6463062
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||| || |||||||| |
|
|
| T |
6463109 |
atccccatgagcttagctcagttggtagggatattgtattttatatgc |
6463062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 260 - 303
Target Start/End: Complemental strand, 8984574 - 8984531
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
8984574 |
ccgtgagcttaactcagttggcagggatattgcatattatatgc |
8984531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 10843388 - 10843341
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||| |||||| ||||||| |
|
|
| T |
10843388 |
atccccgtgaacttagctcagttgataaggataatgcataatatatgc |
10843341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 12404353 - 12404400
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| |||| ||| ||| ||||||||||||||||||||||| |
|
|
| T |
12404353 |
atccccgtgagattagatcaattggtagggatattgcatattatatgc |
12404400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 13538519 - 13538472
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||| |||| ||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
13538519 |
atcccagtgaacttagttcagttggtagggatattgcatattatatgc |
13538472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 14396436 - 14396483
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
14396436 |
atccccatgagcttagctcagttgatagggatatcacattttatatgc |
14396483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 260 - 303
Target Start/End: Original strand, 15595726 - 15595769
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||| ||||||| |
|
|
| T |
15595726 |
ccgtgagcttagctcagttggtagggacattgcataatatatgc |
15595769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 260 - 303
Target Start/End: Original strand, 16182199 - 16182242
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||| ||||| ||| ||||||||||||||||||| |
|
|
| T |
16182199 |
ccgtgagcttagctgagttggtagagatattgcatattatatgc |
16182242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 17671483 - 17671436
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||| | |||||| |
|
|
| T |
17671483 |
atccccgtgagcttagctcagttggtagggatatcgcatttcatatgc |
17671436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 252 - 291
Target Start/End: Complemental strand, 23933145 - 23933106
Alignment:
| Q |
252 |
tttcatccccgtgagcttagctcagttgatagggatattg |
291 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
23933145 |
tttcatccccgtgagcttagctcagttggtagggacattg |
23933106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 259 - 302
Target Start/End: Original strand, 25034904 - 25034947
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||| ||||||| |
|
|
| T |
25034904 |
cccgtgagcttagctcagttggtaggaatattgcattttatatg |
25034947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 260 - 303
Target Start/End: Original strand, 25580689 - 25580732
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| |||||||| ||| ||||||||||||||||||| |
|
|
| T |
25580689 |
ccgtgagcttaactcagttggtagagatattgcatattatatgc |
25580732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 55 - 102
Target Start/End: Complemental strand, 25661325 - 25661278
Alignment:
| Q |
55 |
gaactcaatttataggtgaagaaccaaagataagttacaaatccaatg |
102 |
Q |
| |
|
|||||| ||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
25661325 |
gaactctatttataggtgaagaggcagagataagttacaaatccaatg |
25661278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 27650694 - 27650741
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||| |||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
27650694 |
atcctcgtgagctaagttcagttggtagggatattgcatattatatgc |
27650741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 260 - 303
Target Start/End: Original strand, 33033127 - 33033170
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
33033127 |
ccgtgagcttaattcagttggtagggatattgcatattatatgc |
33033170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 34580859 - 34580812
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| | |||||||||| ||||||||||| ||||||||||| |
|
|
| T |
34580859 |
atccccgtgagttcagctcagttggtagggatattgtatattatatgc |
34580812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 252 - 303
Target Start/End: Complemental strand, 41710000 - 41709949
Alignment:
| Q |
252 |
tttcatccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||| |||||||||||||| ||||| |||||||||||| | |||||||| |
|
|
| T |
41710000 |
tttcatctccgtgagcttagcttagttggtagggatattgcgtgttatatgc |
41709949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 43668030 - 43667983
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||| |||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
43668030 |
atccccgtaagcttagctcagttcgtagagatattgcatattatatgc |
43667983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 45271763 - 45271810
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||| | ||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
45271763 |
atccccgttaacttagttcagttggtagggatattgcatattatatgc |
45271810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 254 - 301
Target Start/End: Complemental strand, 45517343 - 45517296
Alignment:
| Q |
254 |
tcatccccgtgagcttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
||||| |||||||||||| ||||||| |||||||||||||| |||||| |
|
|
| T |
45517343 |
tcatctccgtgagcttagttcagttggtagggatattgcattttatat |
45517296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 46021952 - 46021905
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
46021952 |
atccccgtgagcgtagctcagtaagtagggatattgcatattatatgc |
46021905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 260 - 303
Target Start/End: Complemental strand, 46867923 - 46867880
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||| |||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
46867923 |
ccgtgaacttaactcagttcatagggatattgcatattatatgc |
46867880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 48897190 - 48897143
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||| |||| ||| |||| |||||||||||||||||| |
|
|
| T |
48897190 |
atccccgtgagcttaactcatttggtaggaatattgcatattatatgc |
48897143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 263 - 301
Target Start/End: Complemental strand, 2846776 - 2846738
Alignment:
| Q |
263 |
tgagcttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
2846776 |
tgagtttagctcagttgatagggatattgcattttatat |
2846738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 261 - 303
Target Start/End: Complemental strand, 6712177 - 6712135
Alignment:
| Q |
261 |
cgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||| |||||||| |
|
|
| T |
6712177 |
cgtgagcttagctcagttggtaggtatattgcattttatatgc |
6712135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 257 - 303
Target Start/End: Complemental strand, 12650456 - 12650410
Alignment:
| Q |
257 |
tccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||| ||||||||||||| || ||||||||||| |||||||| |
|
|
| T |
12650456 |
tccccgtgaacttagctcagttggtaaggatattgcatgttatatgc |
12650410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 261 - 303
Target Start/End: Complemental strand, 13794570 - 13794528
Alignment:
| Q |
261 |
cgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||| ||||||| |
|
|
| T |
13794570 |
cgtgagcttagctcagttgataaggataatgcataatatatgc |
13794528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 256 - 302
Target Start/End: Original strand, 27344476 - 27344522
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||| ||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
27344476 |
atcctcgtgagcttagctcagttggtagacatattgcatattatatg |
27344522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 265 - 303
Target Start/End: Complemental strand, 27642790 - 27642752
Alignment:
| Q |
265 |
agcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
27642790 |
agcttagctcagttggtagggatattgcattttatatgc |
27642752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 302
Target Start/End: Original strand, 28867480 - 28867522
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||| ||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
28867480 |
ccgtgaacttagctcagttggtaggaatattgcatattatatg |
28867522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 302
Target Start/End: Original strand, 34485875 - 34485917
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||||| |||||| |
|
|
| T |
34485875 |
ccgtgagcttagctcagttgatggggataatgcataatatatg |
34485917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 303
Target Start/End: Complemental strand, 47930731 - 47930697
Alignment:
| Q |
269 |
tagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
47930731 |
tagctcagttggtagggatattgcatattatatgc |
47930697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 301
Target Start/End: Complemental strand, 11081288 - 11081244
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
||||||||||||||| |||||||| || |||||||||||||||||| |
|
|
| T |
11081288 |
atccccgtgagcttaactcagttgcta-ggatattgcatattatat |
11081244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 261 - 302
Target Start/End: Original strand, 14349646 - 14349687
Alignment:
| Q |
261 |
cgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
||||| ||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
14349646 |
cgtgaacttagctcagttggtagagatattgcatattatatg |
14349687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 301
Target Start/End: Original strand, 14519317 - 14519362
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
||||| ||||| ||| ||||||||||||||||||| |||||||||| |
|
|
| T |
14519317 |
atcccggtgagtttatctcagttgatagggatattccatattatat |
14519362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 262 - 303
Target Start/End: Original strand, 17580320 - 17580361
Alignment:
| Q |
262 |
gtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
17580320 |
gtgaacttagctcagttggtagggatattgcatgttatatgc |
17580361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #136
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 301
Target Start/End: Complemental strand, 31762069 - 31762024
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
||||| |||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
31762069 |
atcccagtgagcttagctcagttggcagtgatattgcatattatat |
31762024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #137
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 258 - 295
Target Start/End: Complemental strand, 36666647 - 36666610
Alignment:
| Q |
258 |
ccccgtgagcttagctcagttgatagggatattgcata |
295 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
36666647 |
ccccgtgagcttagctcagttggtagggacattgcata |
36666610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #138
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 258 - 303
Target Start/End: Original strand, 49253609 - 49253653
Alignment:
| Q |
258 |
ccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||| ||||| |||| |||||||||||||||||| |
|
|
| T |
49253609 |
ccccgtgagcttagctaagttggtagg-atattgcatattatatgc |
49253653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #139
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 267 - 303
Target Start/End: Original strand, 782176 - 782212
Alignment:
| Q |
267 |
cttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
782176 |
cttagctcagttgatatggatattgcataatatatgc |
782212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #140
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 259 - 303
Target Start/End: Complemental strand, 923174 - 923130
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||| ||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
923174 |
cccgtgaatttagcgcagttggtagggatattgcatattatatgc |
923130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #141
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 112 - 160
Target Start/End: Original strand, 9252967 - 9253015
Alignment:
| Q |
112 |
agttgaccgttagaaaatcaatggcttgatctctcatcataaatgagca |
160 |
Q |
| |
|
|||| ||||||| ||||||||||||| ||||| || ||||||||||||| |
|
|
| T |
9252967 |
agttaaccgttacaaaatcaatggctcgatctatcctcataaatgagca |
9253015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #142
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 112 - 164
Target Start/End: Complemental strand, 9327901 - 9327849
Alignment:
| Q |
112 |
agttgaccgttagaaaatcaatggcttgatctctcatcataaatgagcactaa |
164 |
Q |
| |
|
|||||||||||| |||||||||| ||||||| | ||||||||||||||||| |
|
|
| T |
9327901 |
agttgaccgttacgaaatcaatggtttgatctagcctcataaatgagcactaa |
9327849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #143
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 270 - 302
Target Start/End: Complemental strand, 18589822 - 18589790
Alignment:
| Q |
270 |
agctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
18589822 |
agcttagttgatagggatattgcatattatatg |
18589790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #144
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 303
Target Start/End: Complemental strand, 23369120 - 23369080
Alignment:
| Q |
263 |
tgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||| |||||||||| ||||||||| ||||||||||| |
|
|
| T |
23369120 |
tgagcttaactcagttgatcgggatattgtatattatatgc |
23369080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #145
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 267 - 303
Target Start/End: Original strand, 24253780 - 24253816
Alignment:
| Q |
267 |
cttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
24253780 |
cttagctcatttggtagggatattgcatattatatgc |
24253816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #146
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 303
Target Start/End: Original strand, 31818598 - 31818638
Alignment:
| Q |
263 |
tgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||| ||||||| |||| |||||||||||||||||| |
|
|
| T |
31818598 |
tgagcttagttcagttgctaggaatattgcatattatatgc |
31818638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #147
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 259 - 303
Target Start/End: Complemental strand, 42550079 - 42550035
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||| | | |||||||||||||||||| |||| |
|
|
| T |
42550079 |
cccgtgagcttagctcaatcggtagggatattgcatattacatgc |
42550035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #148
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 267 - 303
Target Start/End: Complemental strand, 50824472 - 50824436
Alignment:
| Q |
267 |
cttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
50824472 |
cttagttcagttggtagggatattgcatattatatgc |
50824436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 117; Significance: 1e-59; HSPs: 154)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 3 - 179
Target Start/End: Complemental strand, 55081218 - 55081047
Alignment:
| Q |
3 |
tttgacaactcaagagaacttttggtatggtatgagtagaagtgagggaggggaactcaatttataggtgaagaaccaaagataagttacaaatccaatg |
102 |
Q |
| |
|
||||||||||||||||||||||| || || |||||||||||||||| ||| ||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
55081218 |
tttgacaactcaagagaacttttagtgtg-----agtagaagtgagggagaggagctcaatttataggtgaagagccaaagataagttacaaatccaatg |
55081124 |
T |
 |
| Q |
103 |
gctaggattagttgaccgttagaaaatcaatggcttgatctctcatcataaatgagcactaattgagaaagttgaca |
179 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| ||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
55081123 |
gctaggattaaatgaccgttagaaaatcaatggctttatctcacctcataaatgagcactaattgagaaagttgaca |
55081047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 3 - 173
Target Start/End: Complemental strand, 33722425 - 33722259
Alignment:
| Q |
3 |
tttgacaactcaagagaacttttggtatggtatgagtagaagtgagggaggggaactcaatttataggtgaagaaccaaagataagttacaaatccaatg |
102 |
Q |
| |
|
||||||||||||| ||||||||| ||| ||||||||||||||||||| ||| ||||||||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
33722425 |
tttgacaactcaaaagaactttt----tgggatgagtagaagtgagggagaggagctcaatttataggtgaagagccaaagataagttacaaatctaatg |
33722330 |
T |
 |
| Q |
103 |
gctaggattagttgaccgttagaaaatcaatggcttgatctctcatcataaatgagcactaattgagaaag |
173 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
33722329 |
gctatgattaattgaccgttagaaaatcaatgacttgatctcgcatcataaatgagcactaattgaaaaag |
33722259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 3 - 179
Target Start/End: Original strand, 20513685 - 20513856
Alignment:
| Q |
3 |
tttgacaactcaagagaacttttggtatggtatgagtagaagtgagggaggggaactcaatttataggtgaagaaccaaagataagttacaaatccaatg |
102 |
Q |
| |
|
|||||||||||||||||||||||| || |||||| ||||||||||| || ||||||||||||||| || ||||||||||||| ||||||||||| |
|
|
| T |
20513685 |
tttgacaactcaagagaacttttga----gt-tgagtaaaagtgagggagatgagctcaatttataggtgttgagccaaagataagttgcaaatccaatg |
20513779 |
T |
 |
| Q |
103 |
gctaggattagttgaccgttagaaaatcaatggcttgatctctcatcataaatgagcactaattgagaaagttgaca |
179 |
Q |
| |
|
| ||| |||||||||||||||||||||||||| ||||| ||| ||| ||||||||||||||||| | |||||||||| |
|
|
| T |
20513780 |
gttagaattagttgaccgttagaaaatcaatgacttgaactcgcattataaatgagcactaattaaaaaagttgaca |
20513856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 7 - 162
Target Start/End: Complemental strand, 16595481 - 16595331
Alignment:
| Q |
7 |
acaactcaagagaacttttggtatggtatgagtagaagtgagggaggggaactcaatttataggtgaagaaccaaagataagttacaaatccaatggcta |
106 |
Q |
| |
|
||||||||||||||||||||| ||| || |||||||| ||||| ||||||| ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
16595481 |
acaactcaagagaacttttgg---ggt--gattagaagtgggggagaggaactctatttataggtgaagagccaaagataagttacaaatccaatggcta |
16595387 |
T |
 |
| Q |
107 |
ggattagttgaccgttagaaaatcaatggcttgatctctcatcataaatgagcact |
162 |
Q |
| |
|
||||||||||||| || |||||||||| | |||| |||| ||||||||||||||| |
|
|
| T |
16595386 |
ggattagttgacctctacaaaatcaatgacatgatttctcctcataaatgagcact |
16595331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 2574854 - 2574684
Alignment:
| Q |
3 |
tttgacaactcaagagaacttttggtatggtatgagtagaagtgagggaggggaactcaatttataggtgaagaaccaaagataagttacaaatccaatg |
102 |
Q |
| |
|
|||||||||||||||||||||||| | ||| |||| |||||| |||| || |||||||||||| ||| |||||||||||||| ||||||||||| | |
|
|
| T |
2574854 |
tttgacaactcaagagaacttttgat---gta--agtacaagtgaaggagtggcgctcaatttatagatgatgaaccaaagataagatacaaatccaacg |
2574760 |
T |
 |
| Q |
103 |
gctaggattagttgaccgttagaaaatcaatggcttgatctctcatcataaatgagcactaattgagaaagttgac |
178 |
Q |
| |
|
||||| ||||||||| ||||| |||||||| |||||||| || | |||||||||||||||||| | |||| ||||| |
|
|
| T |
2574759 |
gctagaattagttgatcgttataaaatcaacggcttgatatcgcctcataaatgagcactaatggtgaaaattgac |
2574684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 35 - 162
Target Start/End: Complemental strand, 7216717 - 7216590
Alignment:
| Q |
35 |
tgagtagaagtgagggaggggaactcaatttataggtgaagaaccaaagataagttacaaatccaatggctaggattagttgaccgttagaaaatcaatg |
134 |
Q |
| |
|
|||||||||||||||||| ||| ||| |||| |||||||||| ||||||| |||||||||| ||||||||| |||||||||||| || |||||||||| |
|
|
| T |
7216717 |
tgagtagaagtgagggagaggagctctatttgtaggtgaagaggcaaagatgagttacaaattcaatggctaagattagttgacctctacaaaatcaatg |
7216618 |
T |
 |
| Q |
135 |
gcttgatctctcatcataaatgagcact |
162 |
Q |
| |
|
| |||| |||| ||||||||||||||| |
|
|
| T |
7216617 |
acatgatttctcctcataaatgagcact |
7216590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 4234358 - 4234311
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4234358 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
4234311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 11375962 - 11375915
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11375962 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
11375915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 254 - 303
Target Start/End: Complemental strand, 55251426 - 55251377
Alignment:
| Q |
254 |
tcatccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
55251426 |
tcatccccgtgagcttagctcagttggtagggatattgcatattatatgc |
55251377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 255 - 303
Target Start/End: Complemental strand, 1458092 - 1458044
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1458092 |
catccccgtaagcttagctcagttgatagggatattgcatattatatgc |
1458044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 259 - 303
Target Start/End: Complemental strand, 39697932 - 39697888
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39697932 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
39697888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 3847678 - 3847725
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3847678 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
3847725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 6371111 - 6371158
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6371111 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
6371158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 8965091 - 8965138
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8965091 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
8965138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 24680159 - 24680112
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24680159 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
24680112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 26868346 - 26868393
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26868346 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
26868393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 26919541 - 26919494
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26919541 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
26919494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 37935858 - 37935905
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37935858 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
37935905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 39023172 - 39023219
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39023172 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
39023219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 255 - 302
Target Start/End: Original strand, 40051618 - 40051665
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40051618 |
catccccgtgagcttagctcagttggtagggatattgcatattatatg |
40051665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 43147457 - 43147410
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43147457 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
43147410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 43207666 - 43207713
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43207666 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
43207713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 43596892 - 43596939
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43596892 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
43596939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 46105532 - 46105579
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
46105532 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
46105579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 46775103 - 46775056
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
46775103 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
46775056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 48569249 - 48569202
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
48569249 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
48569202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 49901479 - 49901526
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
49901479 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
49901526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 256 - 301
Target Start/End: Complemental strand, 8433696 - 8433651
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8433696 |
atccccgtgagcttagctcagttggtagggatattgcatattatat |
8433651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 254 - 303
Target Start/End: Original strand, 44602480 - 44602529
Alignment:
| Q |
254 |
tcatccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
44602480 |
tcatccccgtgagcttagctcagttggtagggatattgcattttatatgc |
44602529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 255 - 303
Target Start/End: Complemental strand, 3764082 - 3764034
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
3764082 |
catccccgtgagcttagctcagttggtagggatattacatattatatgc |
3764034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 259 - 303
Target Start/End: Original strand, 4105727 - 4105771
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4105727 |
cccgtgagcttagctcagttgatagggatattgcattttatatgc |
4105771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 259 - 303
Target Start/End: Complemental strand, 22230504 - 22230460
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
22230504 |
cccgtgagcttagctcagttggtagggatattgcatattatatgc |
22230460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 259 - 303
Target Start/End: Complemental strand, 22788744 - 22788700
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
22788744 |
cccgtgagcttagctcagttggtagggatattgcatattatatgc |
22788700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 255 - 303
Target Start/End: Complemental strand, 23705227 - 23705179
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
23705227 |
catccccgtgagcttagctcagttggtagggatattgcatattacatgc |
23705179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 255 - 303
Target Start/End: Complemental strand, 25235871 - 25235823
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
25235871 |
catccccgtgagcttagcttagttggtagggatattgcatattatatgc |
25235823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 259 - 303
Target Start/End: Original strand, 43978008 - 43978052
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43978008 |
cccgtgagcttagctcagttggtagggatattgcatattatatgc |
43978052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 255 - 303
Target Start/End: Complemental strand, 45112185 - 45112137
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
45112185 |
catccccgtgagcttacctcagttggtagggatattgcatattatatgc |
45112137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 255 - 303
Target Start/End: Complemental strand, 47934146 - 47934098
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
47934146 |
catccccgtgagcttagctcagttggtagggatatggcatattatatgc |
47934098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 260 - 303
Target Start/End: Complemental strand, 542883 - 542840
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
542883 |
ccgtgagcttagctcagttgatagggatattgcatattgtatgc |
542840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 3036128 - 3036081
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
3036128 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgc |
3036081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 4958629 - 4958582
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
4958629 |
atccccgtgagcttagttcagttggtagggatattgcatattatatgc |
4958582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 9761112 - 9761159
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
9761112 |
atccccgtgagcttacctcagttggtagggatattgcatattatatgc |
9761159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 260 - 303
Target Start/End: Original strand, 30217600 - 30217643
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30217600 |
ccgtgagcttagctcagttggtagggatattgcatattatatgc |
30217643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 260 - 303
Target Start/End: Original strand, 34353780 - 34353823
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34353780 |
ccgtgagcttagctcagttggtagggatattgcatattatatgc |
34353823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 260 - 303
Target Start/End: Complemental strand, 35207220 - 35207177
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
35207220 |
ccgtgagcttaactcagttgatagggatattgcatattatatgc |
35207177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 259 - 302
Target Start/End: Complemental strand, 40994173 - 40994130
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40994173 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
40994130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 260 - 303
Target Start/End: Complemental strand, 43271786 - 43271743
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
43271786 |
ccgtgagcttagttcagttgatagggatattgcatattatatgc |
43271743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 45126129 - 45126176
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
45126129 |
atccccgtgagcttagctcagttggtagggatattgtatattatatgc |
45126176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 45849044 - 45849091
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
45849044 |
atccccgtgagcttagctcagttggtagggatattgcatattttatgc |
45849091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 51512082 - 51512035
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
51512082 |
atccccgtgagctgagctcagttggtagggatattgcatattatatgc |
51512035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 52798275 - 52798322
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
52798275 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgc |
52798322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 260 - 303
Target Start/End: Complemental strand, 53572396 - 53572353
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
53572396 |
ccgtgagcttaactcagttgatagggatattgcatattatatgc |
53572353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 55238572 - 55238525
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
55238572 |
atccccgtgagcttagcttagttggtagggatattgcatattatatgc |
55238525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 55536377 - 55536424
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
55536377 |
atccccgtgagcttagctcagttggtaaggatattgcatattatatgc |
55536424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 55853181 - 55853134
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
55853181 |
atccccgtgagcttagctcagttggtagagatattgcatattatatgc |
55853134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 256 - 298
Target Start/End: Complemental strand, 35219573 - 35219531
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatatta |
298 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
35219573 |
atccccgtgagcttagctcagttggtagggatattgcatatta |
35219531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 256 - 301
Target Start/End: Original strand, 4590243 - 4590288
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
4590243 |
atccccgtgagtttagctcagttggtagggatattgcatattatat |
4590288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 256 - 301
Target Start/End: Original strand, 35465432 - 35465477
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
35465432 |
atccccgtgagcttagctcagttggtagggatattgcattttatat |
35465477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 261 - 302
Target Start/End: Complemental strand, 39696405 - 39696364
Alignment:
| Q |
261 |
cgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
39696405 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
39696364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 254 - 303
Target Start/End: Complemental strand, 49757359 - 49757310
Alignment:
| Q |
254 |
tcatccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||| ||||||||||| |||| |||||||||||||||||| |
|
|
| T |
49757359 |
tcatccccgtgagcatagctcagttggtaggaatattgcatattatatgc |
49757310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 259 - 303
Target Start/End: Original strand, 3815060 - 3815104
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
3815060 |
cccgtgagcttagcttagttggtagggatattgcatattatatgc |
3815104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 255 - 303
Target Start/End: Complemental strand, 10417295 - 10417247
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
10417295 |
catccccatgagcttagctcagttggtagggatattacatattatatgc |
10417247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 259 - 303
Target Start/End: Complemental strand, 27743778 - 27743734
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27743778 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgc |
27743734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 82 - 178
Target Start/End: Complemental strand, 39991369 - 39991273
Alignment:
| Q |
82 |
agataagttacaaatccaatggctaggattagttgaccgttagaaaatcaatggcttgatctctcatcataaatgagcactaattgagaaagttgac |
178 |
Q |
| |
|
||||||||||||||| ||||||||| ||| | |||||||||| |||||||| | ||||||| ||||||||||||||| | ||||| ||||||| |
|
|
| T |
39991369 |
agataagttacaaattcaatggctatgatcatttgaccgttacaaaatcaacgatctgatctcgtctcataaatgagcactcagtgagagagttgac |
39991273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 256 - 300
Target Start/End: Original strand, 42218747 - 42218791
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattata |
300 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
42218747 |
atccccgtgaacttagctcagttggtagggatattgcatattata |
42218791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 255 - 303
Target Start/End: Original strand, 45673648 - 45673696
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||| |||||||| |||| |||||||||||||||||| |
|
|
| T |
45673648 |
catccccgtgagcttaactcagttggtaggaatattgcatattatatgc |
45673696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 256 - 300
Target Start/End: Original strand, 48798276 - 48798320
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattata |
300 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
48798276 |
atccccgtgagcttagctcagttggtagggatattgcattttata |
48798320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 259 - 303
Target Start/End: Complemental strand, 50457784 - 50457740
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
50457784 |
cccgtgagcttagctcagttggtaaggatattgcatattatatgc |
50457740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 637096 - 637143
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||| || |||| |||||||||||||||||| |
|
|
| T |
637096 |
atccccgtgagcttagctcagctggtaggaatattgcatattatatgc |
637143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 260 - 303
Target Start/End: Original strand, 2771037 - 2771080
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
2771037 |
ccgtgagcttagctcagctgatatggatattgcatattatatgc |
2771080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 3157290 - 3157243
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||| ||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
3157290 |
atccccgtgaacttagctcagttggtaggaatattgcatattatatgc |
3157243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 5165854 - 5165901
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||| ||||||||||||| |
|
|
| T |
5165854 |
atccccgtgagcttaactcagttggtagggatatcgcatattatatgc |
5165901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 7686335 - 7686288
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||||| |||||||| |
|
|
| T |
7686335 |
atccccgtgagcttagctcagttggtagagatattgcattttatatgc |
7686288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 10402438 - 10402485
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||| |||||||| ||| ||||||||||||||||||| |
|
|
| T |
10402438 |
atccccgtgagcttaactcagttggtagagatattgcatattatatgc |
10402485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 12504716 - 12504669
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||| |||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
12504716 |
atcctcgtgagcttatctcagttggtagggatattgcatattatatgc |
12504669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 13264347 - 13264300
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||| ||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
13264347 |
atccccatgagcttcgctcagttggtagggatattgcatattatatgc |
13264300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 260 - 303
Target Start/End: Complemental strand, 13578534 - 13578491
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
13578534 |
ccgtgagcttaactcagttggtagggatattgcatattatatgc |
13578491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 21935474 - 21935521
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
21935474 |
atccccgcaagcttagctcagttggtagggatattgcatattatatgc |
21935521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 46582631 - 46582678
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||| ||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
46582631 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgc |
46582678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 255 - 302
Target Start/End: Original strand, 49447117 - 49447164
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
||||||| ||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
49447117 |
catccccatgagcttagctcagttggtaaggatattgcatattatatg |
49447164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 50512357 - 50512404
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||| ||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
50512357 |
atccccatgagcttagctcagttggtaggaatattgcatattatatgc |
50512404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 52757351 - 52757304
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
52757351 |
atccccgtgagcttagctcagttggcaggaatattgcatattatatgc |
52757304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 54103637 - 54103590
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||| | ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
54103637 |
atccccgtgcgtttaactcagttgatagggatattgcatattatatgc |
54103590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 256 - 302
Target Start/End: Complemental strand, 921552 - 921506
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
||||||| |||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
921552 |
atccccgcgagcttagctcagttgatagagataatgcatattatatg |
921506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 256 - 302
Target Start/End: Original strand, 19594230 - 19594276
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||| |||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
19594230 |
atcctcgtgagcttaactcagttgatagagatattgcatattatatg |
19594276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 261 - 303
Target Start/End: Complemental strand, 29771367 - 29771325
Alignment:
| Q |
261 |
cgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
29771367 |
cgtgagcttagctcaattggtagggatattgcatattatatgc |
29771325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 256 - 302
Target Start/End: Complemental strand, 31852686 - 31852640
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
||||||||||||||| |||||||| ||||| |||||||||||||||| |
|
|
| T |
31852686 |
atccccgtgagcttatctcagttggtagggttattgcatattatatg |
31852640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 252 - 302
Target Start/End: Original strand, 33530786 - 33530836
Alignment:
| Q |
252 |
tttcatccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||| ||||||||||||| | ||| |||||||||||||||||||||| |
|
|
| T |
33530786 |
tttcatcctcgtgagcttagcttaattggtagggatattgcatattatatg |
33530836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 257 - 303
Target Start/End: Complemental strand, 33933811 - 33933765
Alignment:
| Q |
257 |
tccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||||| |||||| |||||||| ||||||| |
|
|
| T |
33933811 |
tccccgtgagcttagctcagttggtagggacattgcataatatatgc |
33933765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 252 - 302
Target Start/End: Original strand, 34040421 - 34040471
Alignment:
| Q |
252 |
tttcatccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
34040421 |
tttcatccacgtgagcttagctcagttgatagaaatattgcattttatatg |
34040471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 257 - 303
Target Start/End: Original strand, 37251111 - 37251157
Alignment:
| Q |
257 |
tccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||||||| ||||| |
|
|
| T |
37251111 |
tccccgtgagcttaactcagttggtagggatattgcatattttatgc |
37251157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 262 - 303
Target Start/End: Complemental strand, 627049 - 627008
Alignment:
| Q |
262 |
gtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
627049 |
gtgagtttagctcagttggtagggatattgcatattatatgc |
627008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 256 - 301
Target Start/End: Original strand, 12763753 - 12763798
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
|||||||| | ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
12763753 |
atccccgtaaacttagctcagttgctagggatattgcatattatat |
12763798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 256 - 301
Target Start/End: Original strand, 15208519 - 15208564
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
||||||||||||||| |||||| | ||||||||||||||||||||| |
|
|
| T |
15208519 |
atccccgtgagcttaactcagtgggtagggatattgcatattatat |
15208564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 260 - 301
Target Start/End: Complemental strand, 25726378 - 25726337
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
25726378 |
ccgtgggcttagctcagttggtagggatattgcatattatat |
25726337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 261 - 302
Target Start/End: Original strand, 36215322 - 36215363
Alignment:
| Q |
261 |
cgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
36215322 |
cgtgagcttagatcagttgatagggatattgtatattatatg |
36215363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 257 - 302
Target Start/End: Original strand, 42395225 - 42395270
Alignment:
| Q |
257 |
tccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||| |||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
42395225 |
tccctgtgagcttagcttagttggtagggatattgcatattatatg |
42395270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 255 - 303
Target Start/End: Original strand, 8282338 - 8282386
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||| ||||||||||| |||| |||||| |||||||||||||||||||| |
|
|
| T |
8282338 |
catctccgtgagcttaactcaattgataaggatattgcatattatatgc |
8282386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 259 - 303
Target Start/End: Complemental strand, 15604110 - 15604066
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||| |||||||| |
|
|
| T |
15604110 |
cccgtgagcttagctcagttggtagggatgttgcattttatatgc |
15604066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 256 - 300
Target Start/End: Complemental strand, 21380255 - 21380211
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattata |
300 |
Q |
| |
|
||||||||||| |||||||| ||| |||||||||||||||||||| |
|
|
| T |
21380255 |
atccccgtgagtttagctcaattgctagggatattgcatattata |
21380211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 259 - 299
Target Start/End: Complemental strand, 24997504 - 24997464
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattat |
299 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
24997504 |
cccgtgagcttagctcagttggtagggatattgcattttat |
24997464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 259 - 303
Target Start/End: Original strand, 42231512 - 42231556
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||| |||||||| |||| |||||||||||||||||| |
|
|
| T |
42231512 |
cccgtgagcttaactcagttggtaggaatattgcatattatatgc |
42231556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 255 - 303
Target Start/End: Complemental strand, 43481113 - 43481065
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||||||||| |||||||| |
|
|
| T |
43481113 |
catccccgtgagcttaactcagttggtagggatattgcactttatatgc |
43481065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 259 - 303
Target Start/End: Complemental strand, 44312854 - 44312810
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
44312854 |
cccgcgagcttagctcagttggtagggatattgcattttatatgc |
44312810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 259 - 303
Target Start/End: Complemental strand, 48615542 - 48615498
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
48615542 |
cccgtgagcataactcagttggtagggatattgcatattatatgc |
48615498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 255 - 302
Target Start/End: Original strand, 4357878 - 4357925
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
||||||||||| ||||||||||||| ||| ||||||| |||||||||| |
|
|
| T |
4357878 |
catccccgtgaacttagctcagttggtagagatattgtatattatatg |
4357925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 5179955 - 5179908
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||| |||| |||||||| || |||||||||||||||||||| |
|
|
| T |
5179955 |
atccccgtgaacttaactcagttggtaaggatattgcatattatatgc |
5179908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 262 - 301
Target Start/End: Complemental strand, 8848279 - 8848240
Alignment:
| Q |
262 |
gtgagcttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
8848279 |
gtgagcttagttcagttggtagggatattgcatattatat |
8848240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 12167689 - 12167642
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||| |||| |||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
12167689 |
atccctgtgaacttaactcagttggtagggatattgcatattatatgc |
12167642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 18360490 - 18360537
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||| |||||||| |
|
|
| T |
18360490 |
atccccgtgagcttagctcagttggtagggatatcacattttatatgc |
18360537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 259 - 302
Target Start/End: Complemental strand, 18424967 - 18424924
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
||||||| |||| |||||||| |||||||||||||||||||||| |
|
|
| T |
18424967 |
cccgtgaacttaactcagttggtagggatattgcatattatatg |
18424924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 21116778 - 21116825
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||| |||||||| || | |||||||||||||||||| |
|
|
| T |
21116778 |
atccccgtgagcttaactcagttgttaagaatattgcatattatatgc |
21116825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 23787412 - 23787365
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||| |||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
23787412 |
atccctgtgagcataactcagttggtagggatattgcatattatatgc |
23787365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 26347139 - 26347092
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| ||| ||||||| ||||||||||||||| |||||||| |
|
|
| T |
26347139 |
atccccgtgagtttaactcagttaatagggatattgcatgttatatgc |
26347092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 264 - 303
Target Start/End: Original strand, 32339329 - 32339368
Alignment:
| Q |
264 |
gagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
32339329 |
gagcttaactcagttgttagggatattgcatattatatgc |
32339368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 36132226 - 36132273
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| |||||||| ||| |||| |||||||||||||||||| |
|
|
| T |
36132226 |
atccccgtgagtttagctcaattggtaggaatattgcatattatatgc |
36132273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 36602439 - 36602392
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||| |||||||| |
|
|
| T |
36602439 |
atccccgtgagcttagctcagttggtagggatatcacattttatatgc |
36602392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 84 - 167
Target Start/End: Complemental strand, 40684303 - 40684220
Alignment:
| Q |
84 |
ataagttacaaatccaatggctaggattagttgaccgttagaaaatcaatggcttgatctctcatcataaatgagcactaattg |
167 |
Q |
| |
|
|||||||||||||| ||| | |||||||||||| | || |||||||||||| |||||| | ||||||||||||||| |||| |
|
|
| T |
40684303 |
ataagttacaaatctaatagtcgggattagttgactggtacaaaatcaatggcatgatcttgcctcataaatgagcactcattg |
40684220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 259 - 302
Target Start/End: Complemental strand, 42381183 - 42381140
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
||||||| ||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
42381183 |
cccgtgaacttagctcagttggtagggatattgcatgttatatg |
42381140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 50442814 - 50442767
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||| |||||||||||||||||| |||||||| |||||| ||||||| |
|
|
| T |
50442814 |
atccctgtgagcttagctcagttggtagggataatgcataatatatgc |
50442767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 53376752 - 53376705
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||| |||||||||||| ||| |||||||||||||| |||||||| |
|
|
| T |
53376752 |
atccccgcgagcttagctcaattggtagggatattgcatgttatatgc |
53376705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 268 - 303
Target Start/End: Original strand, 54534835 - 54534870
Alignment:
| Q |
268 |
ttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
54534835 |
ttagctcagttggtagggatattgcatattatatgc |
54534870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 56088027 - 56087980
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||| | ||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
56088027 |
atccccataagcttagctcagttggtagggatattgcattttatatgc |
56087980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 268 - 302
Target Start/End: Original strand, 7272526 - 7272560
Alignment:
| Q |
268 |
ttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7272526 |
ttagctcagttgataaggatattgcatattatatg |
7272560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 261 - 303
Target Start/End: Complemental strand, 15064270 - 15064228
Alignment:
| Q |
261 |
cgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||| |||||||||||| |||| |||||||||||||||||| |
|
|
| T |
15064270 |
cgtgagtttagctcagttggtaggaatattgcatattatatgc |
15064228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 261 - 303
Target Start/End: Original strand, 20203428 - 20203470
Alignment:
| Q |
261 |
cgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||| ||| ||| ||||||||||||||||||| |
|
|
| T |
20203428 |
cgtgagcttagctcatttggtagagatattgcatattatatgc |
20203470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 302
Target Start/End: Complemental strand, 27103170 - 27103128
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
||||| |||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
27103170 |
ccgtgtgcttagcttagttggtagggatattgcatattatatg |
27103128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 256 - 302
Target Start/End: Complemental strand, 29329896 - 29329850
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||| || ||||||| |
|
|
| T |
29329896 |
atccccgtgagcttagctcagttggtaggaatattgtattttatatg |
29329850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 303
Target Start/End: Original strand, 30057232 - 30057266
Alignment:
| Q |
269 |
tagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30057232 |
tagctcagttggtagggatattgcatattatatgc |
30057266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 257 - 295
Target Start/End: Original strand, 32293106 - 32293144
Alignment:
| Q |
257 |
tccccgtgagcttagctcagttgatagggatattgcata |
295 |
Q |
| |
|
|||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
32293106 |
tccccgtgagcttagctcagttgataaggacattgcata |
32293144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 302
Target Start/End: Original strand, 38228438 - 38228480
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||| ||||||| |
|
|
| T |
38228438 |
ccgtgagcttagatcagttggtagggatattgcatgttatatg |
38228480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 256 - 302
Target Start/End: Complemental strand, 46582412 - 46582366
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||| ||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
46582412 |
atcctcgtgagcttagatcagttgatgaggatattgcatattatatg |
46582366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 254 - 300
Target Start/End: Original strand, 49315986 - 49316032
Alignment:
| Q |
254 |
tcatccccgtgagcttagctcagttgatagggatattgcatattata |
300 |
Q |
| |
|
|||| |||||||||||| ||||||||||| |||||||| |||||||| |
|
|
| T |
49315986 |
tcattcccgtgagcttaactcagttgataaggatattgtatattata |
49316032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 256 - 302
Target Start/End: Complemental strand, 52483249 - 52483204
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||||||||||||||||||| || |||| |||||||||||||| |
|
|
| T |
52483249 |
atccccgtgagcttagctcagttggta-ggatgttgcatattatatg |
52483204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 257 - 303
Target Start/End: Original strand, 55055914 - 55055960
Alignment:
| Q |
257 |
tccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||||| |||||| | |||||||| ||||| |
|
|
| T |
55055914 |
tccccgtgagcttagctcagttggtagggacaatgcatattttatgc |
55055960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 256 - 302
Target Start/End: Complemental strand, 56360785 - 56360739
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||| |
|
|
| T |
56360785 |
atccccgtgaatttagctcagttggtagggatattgcgtattatatg |
56360739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 261 - 303
Target Start/End: Complemental strand, 56479294 - 56479252
Alignment:
| Q |
261 |
cgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||| |||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
56479294 |
cgtgaacttaactcagttggtagggatattgcatattatatgc |
56479252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 262 - 303
Target Start/End: Complemental strand, 16743345 - 16743304
Alignment:
| Q |
262 |
gtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||| ||||||| |
|
|
| T |
16743345 |
gtgagcttagctcagttgatatggataatgcataatatatgc |
16743304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 262 - 303
Target Start/End: Complemental strand, 17815492 - 17815451
Alignment:
| Q |
262 |
gtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||| ||||||| |||||||||| |||||||||||| |
|
|
| T |
17815492 |
gtgagcttagttcagttggtagggatattacatattatatgc |
17815451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 301
Target Start/End: Original strand, 17872084 - 17872129
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
|||||||||||||||||| | ||| ||||||||||||||| ||||| |
|
|
| T |
17872084 |
atccccgtgagcttagcttaattggtagggatattgcatagtatat |
17872129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 262 - 303
Target Start/End: Complemental strand, 25175197 - 25175156
Alignment:
| Q |
262 |
gtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||| ||||||| |||||||||| |||||||||||| |
|
|
| T |
25175197 |
gtgagcttagttcagttggtagggatattacatattatatgc |
25175156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 301
Target Start/End: Complemental strand, 37700672 - 37700627
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
||||||||||| ||| ||| |||| ||||||||||||||||||||| |
|
|
| T |
37700672 |
atccccgtgagtttacctcggttggtagggatattgcatattatat |
37700627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 259 - 303
Target Start/End: Original strand, 49056774 - 49056819
Alignment:
| Q |
259 |
cccgtgagctta-gctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||| ||||||||| |||||| |||||||||||||||| |
|
|
| T |
49056774 |
cccgtgagcttaagctcagttggtagggacattgcatattatatgc |
49056819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 301
Target Start/End: Complemental strand, 53634324 - 53634279
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
|||||| ||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
53634324 |
atccccatgagcttagttcagttcgtagggatattgcatattatat |
53634279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 259 - 303
Target Start/End: Original strand, 1439618 - 1439662
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||| ||||||||||||| || ||| |||||||||||||||| |
|
|
| T |
1439618 |
cccgtgaacttagctcagttggtatggacattgcatattatatgc |
1439662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 303
Target Start/End: Complemental strand, 4701004 - 4700964
Alignment:
| Q |
263 |
tgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||| |||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
4701004 |
tgagtttagctcagttggtagggatattgtatattatatgc |
4700964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #147
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 259 - 303
Target Start/End: Original strand, 6930551 - 6930595
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||| ||||||||| || ||||||||||||||| ||||||| |
|
|
| T |
6930551 |
cccgtgagattagctcagctgctagggatattgcataatatatgc |
6930595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #148
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 262 - 302
Target Start/End: Complemental strand, 10407101 - 10407062
Alignment:
| Q |
262 |
gtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
10407101 |
gtgagcttagctcagttggtagg-atattgcatattatatg |
10407062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #149
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 259 - 303
Target Start/End: Complemental strand, 12582098 - 12582054
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||| | || ||||| ||||||||||||||||||||||| |
|
|
| T |
12582098 |
cccgtgagctaatcttagttggtagggatattgcatattatatgc |
12582054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #150
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 148 - 184
Target Start/End: Complemental strand, 15017417 - 15017381
Alignment:
| Q |
148 |
tcataaatgagcactaattgagaaagttgacaagaga |
184 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
15017417 |
tcataaatgagcaataattgagaaagttgacacgaga |
15017381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #151
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 261 - 301
Target Start/End: Original strand, 21432616 - 21432656
Alignment:
| Q |
261 |
cgtgagcttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
||||||||||| ||||||| ||| ||||||||||||||||| |
|
|
| T |
21432616 |
cgtgagcttagttcagttggtagagatattgcatattatat |
21432656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #152
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 259 - 303
Target Start/End: Original strand, 37719000 - 37719044
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||| |||||||| ||||||||| |||| |||||||| |
|
|
| T |
37719000 |
cccgtgagcttaactcagttgttagggatatcgcattttatatgc |
37719044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #153
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 303
Target Start/End: Complemental strand, 42134523 - 42134483
Alignment:
| Q |
263 |
tgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
42134523 |
tgagcttaactcagttagtagggatattgcatattatatgc |
42134483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #154
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 261 - 301
Target Start/End: Original strand, 52699191 - 52699231
Alignment:
| Q |
261 |
cgtgagcttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
|||||| ||| ||||||||||||| |||||||||||||||| |
|
|
| T |
52699191 |
cgtgagtttaactcagttgataggaatattgcatattatat |
52699231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 97; Significance: 1e-47; HSPs: 123)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 3 - 184
Target Start/End: Complemental strand, 6897918 - 6897742
Alignment:
| Q |
3 |
tttgacaactcaagagaacttttggtatggtatgagtagaagtgagggaggggaactcaatttataggtgaagaaccaaagataagttacaaatccaatg |
102 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||||||||||||| | ||||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
6897918 |
tttgacaactcaagagaacttttgg---ggtt--agtagaagtgagggggaaaaactcaatttataggtgaagagccaaagataagttacaaattcaatg |
6897824 |
T |
 |
| Q |
103 |
gctaggattagttgaccgttagaaaatcaatggcttgatctctcatcataaatgagcactaattgagaaagttgacaagaga |
184 |
Q |
| |
|
||| ||||||||||||||||||||||||||| ||| ||||| ||||||||||||||||||||| | |||||||||| |||| |
|
|
| T |
6897823 |
actatgattagttgaccgttagaaaatcaatgacttaatctcacatcataaatgagcactaattaaaaaagttgacatgaga |
6897742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 255 - 303
Target Start/End: Complemental strand, 12640663 - 12640615
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
12640663 |
catccccgtgagcttagctcagttggtagggatattgcatattatatgc |
12640615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 2228972 - 2229019
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2228972 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
2229019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 2681093 - 2681140
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2681093 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
2681140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 9877340 - 9877293
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9877340 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
9877293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 15238886 - 15238933
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
15238886 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
15238933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 19753041 - 19752994
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19753041 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
19752994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 23102631 - 23102584
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23102631 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
23102584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 25833552 - 25833599
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25833552 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
25833599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 29617402 - 29617449
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29617402 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
29617449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 35950125 - 35950172
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35950125 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
35950172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 42443686 - 42443733
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42443686 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
42443733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 44616599 - 44616646
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44616599 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
44616646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 256 - 302
Target Start/End: Complemental strand, 10244962 - 10244916
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
10244962 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
10244916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 256 - 302
Target Start/End: Complemental strand, 37300172 - 37300126
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
37300172 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
37300126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 256 - 302
Target Start/End: Original strand, 47641042 - 47641088
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
47641042 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
47641088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 256 - 302
Target Start/End: Original strand, 47999777 - 47999823
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
47999777 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
47999823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 255 - 303
Target Start/End: Original strand, 12772111 - 12772159
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
12772111 |
catcctcgtgagcttagctcagttggtagggatattgcatattatatgc |
12772159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 254 - 302
Target Start/End: Original strand, 21066881 - 21066929
Alignment:
| Q |
254 |
tcatccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
21066881 |
tcatccccgtgagtttagctcagttggtagggatattgcatattatatg |
21066929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 259 - 303
Target Start/End: Original strand, 24781030 - 24781074
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24781030 |
cccgtgagcttagctcagttggtagggatattgcatattatatgc |
24781074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 259 - 303
Target Start/End: Complemental strand, 27510327 - 27510283
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27510327 |
cccgtgagcttagctcagttggtagggatattgcatattatatgc |
27510283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 259 - 303
Target Start/End: Complemental strand, 36391974 - 36391930
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36391974 |
cccgtgagcttagctcagttggtagggatattgcatattatatgc |
36391930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 255 - 303
Target Start/End: Complemental strand, 38889567 - 38889519
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
38889567 |
catccccgtgagcttaactcagttggtagggatattgcatattatatgc |
38889519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 3766808 - 3766855
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
3766808 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgc |
3766855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 5990218 - 5990171
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
5990218 |
atccccgtgagcttagctcagttggtagggatattgtatattatatgc |
5990171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 12615748 - 12615795
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
12615748 |
atccccttgagcttaactcagttgatagggatattgcatattatatgc |
12615795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 24061402 - 24061355
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
24061402 |
atccccgtgagcttagctcagttggtaggaatattgcatattatatgc |
24061355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 27424836 - 27424883
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
27424836 |
atccccgtgagcttagctcagttggaagggatattgcatattatatgc |
27424883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 30806112 - 30806159
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30806112 |
atccccgtgagtttagctcagttggtagggatattgcatattatatgc |
30806159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 30940768 - 30940815
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
30940768 |
atccccgtgagcttagctcagttggtagtgatattgcatattatatgc |
30940815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 31026216 - 31026263
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31026216 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgc |
31026263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 260 - 303
Target Start/End: Original strand, 36174391 - 36174434
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36174391 |
ccgtgagcttagctcagttggtagggatattgcatattatatgc |
36174434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 260 - 303
Target Start/End: Complemental strand, 38824694 - 38824651
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38824694 |
ccgtgagcttagctcagttgatagggatattgcgtattatatgc |
38824651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 260 - 303
Target Start/End: Original strand, 41084040 - 41084083
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41084040 |
ccgtgagcttagctcagttggtagggatattgcatattatatgc |
41084083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 46534821 - 46534774
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
46534821 |
atccccatgagcttagctcagttggtagggatattgcatattatatgc |
46534774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 256 - 302
Target Start/End: Complemental strand, 19922169 - 19922123
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
19922169 |
atccccgtgagcttagcttagttgatagggatattgcattttatatg |
19922123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 261 - 303
Target Start/End: Complemental strand, 30388575 - 30388533
Alignment:
| Q |
261 |
cgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30388575 |
cgtgagcttagctcagttggtagggatattgcatattatatgc |
30388533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 257 - 302
Target Start/End: Original strand, 3392465 - 3392510
Alignment:
| Q |
257 |
tccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
3392465 |
tccccgtgagcttaactcagttgatatggatattgcatattatatg |
3392510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 262 - 302
Target Start/End: Complemental strand, 24732618 - 24732578
Alignment:
| Q |
262 |
gtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
24732618 |
gtgagcttagctcagttgttagggatattgcatattatatg |
24732578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 263 - 303
Target Start/End: Complemental strand, 32677008 - 32676968
Alignment:
| Q |
263 |
tgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32677008 |
tgagcttagctcagttggtagggatattgcatattatatgc |
32676968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 255 - 303
Target Start/End: Complemental strand, 33996955 - 33996907
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33996955 |
catccccgtgagtatagctcagttggtagggatattgcatattatatgc |
33996907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 259 - 303
Target Start/End: Complemental strand, 34267621 - 34267577
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
34267621 |
cccgtgagcttagctcagttggtaggaatattgcatattatatgc |
34267577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 261 - 301
Target Start/End: Original strand, 36720109 - 36720149
Alignment:
| Q |
261 |
cgtgagcttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36720109 |
cgtgagcttagctcagttggtagggatattgcatattatat |
36720149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 259 - 303
Target Start/End: Original strand, 41465834 - 41465878
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41465834 |
cccgtaagcttagctcagttggtagggatattgcatattatatgc |
41465878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 260 - 303
Target Start/End: Complemental strand, 9712267 - 9712224
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
9712267 |
ccgtgagcttaactcagttggtagggatattgcatattatatgc |
9712224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 9929977 - 9929930
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
9929977 |
atccccgttagcttagctcagttggtagggatattgaatattatatgc |
9929930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 15106764 - 15106717
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||| ||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
15106764 |
atcccggtgagcttaactcagttggtagggatattgcatattatatgc |
15106717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 259 - 302
Target Start/End: Complemental strand, 18223787 - 18223744
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
18223787 |
cccgtgagcttaactcagttggtagggatattgcatattatatg |
18223744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 21388520 - 21388567
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||| ||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
21388520 |
atccccatgagcgtagctcagttggtagggatattgcatattatatgc |
21388567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 259 - 302
Target Start/End: Complemental strand, 24062081 - 24062038
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
24062081 |
cccgtgagcttagctcagttagtagggatattgcatattatatg |
24062038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 24692472 - 24692519
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
24692472 |
atccccgtgaggttagctcagttggtagggatattgcatattctatgc |
24692519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 29625918 - 29625965
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||| |||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
29625918 |
atccacgtgagcttaactcagttggtagggatattgcatattatatgc |
29625965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 255 - 302
Target Start/End: Original strand, 32619346 - 32619393
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||||||||||| |||||||| || ||||||||||||||||||| |
|
|
| T |
32619346 |
catccccgtgagcttaactcagttgttaaggatattgcatattatatg |
32619393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 262 - 301
Target Start/End: Complemental strand, 32984284 - 32984245
Alignment:
| Q |
262 |
gtgagcttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32984284 |
gtgagcttagctcagttggtagggatattgcatattatat |
32984245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 35815835 - 35815882
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||| |||||||| |
|
|
| T |
35815835 |
atccccgtgagcttagctcagttggtagggatatcgcattttatatgc |
35815882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 36389739 - 36389692
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| || |||||||| |
|
|
| T |
36389739 |
atccccgtgagcttagctcagttggtagggatattgtattttatatgc |
36389692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 36469778 - 36469731
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |||| |
|
|
| T |
36469778 |
atccccgtgagcttagctcagttggtagggatattacatattacatgc |
36469731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 36622171 - 36622218
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||| ||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
36622171 |
atccccgtgaacttagctcaattggtagggatattgcatattatatgc |
36622218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 39098133 - 39098180
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||| |||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
39098133 |
atccctgtgagcttagttcagttggtagggatattgcatattatatgc |
39098180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 48119467 - 48119514
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
48119467 |
atccctgtgagcttagctcagttggtagggatattgcattttatatgc |
48119514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 260 - 303
Target Start/End: Complemental strand, 48288470 - 48288427
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
48288470 |
ccgtgagcttaactcagttggtagggatattgcatattatatgc |
48288427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 257 - 303
Target Start/End: Original strand, 5833037 - 5833083
Alignment:
| Q |
257 |
tccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |||||| ||||||| |
|
|
| T |
5833037 |
tccccgtgagcttagctcagttggtagggataatgcataatatatgc |
5833083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 269 - 303
Target Start/End: Complemental strand, 15074962 - 15074928
Alignment:
| Q |
269 |
tagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
15074962 |
tagctcagttgatagggatattgcatattatatgc |
15074928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 257 - 303
Target Start/End: Complemental strand, 26816730 - 26816684
Alignment:
| Q |
257 |
tccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |||||| ||||||| |
|
|
| T |
26816730 |
tccccgtgagcttagctcagttggtagggataatgcataatatatgc |
26816684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 259 - 297
Target Start/End: Complemental strand, 29281413 - 29281375
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatatt |
297 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
29281413 |
cccgtgagcttaactcagttgatagggatattgcatatt |
29281375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 303
Target Start/End: Original strand, 4960788 - 4960828
Alignment:
| Q |
263 |
tgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4960788 |
tgagcttagctcagttagtagggatattgcatattatatgc |
4960828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 303
Target Start/End: Original strand, 28805304 - 28805344
Alignment:
| Q |
263 |
tgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
28805304 |
tgagcttagctcagttggtagggatattgcatatcatatgc |
28805344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 259 - 303
Target Start/End: Complemental strand, 35683197 - 35683153
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||| |||||||| |
|
|
| T |
35683197 |
cccgtgagcttagctcagttggtagggatatcgcattttatatgc |
35683153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 255 - 303
Target Start/End: Complemental strand, 41913838 - 41913790
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||| |||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
41913838 |
catccccacgagcttagctcagttgatagagatattgcattttatatgc |
41913790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 259 - 303
Target Start/End: Complemental strand, 44593552 - 44593508
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||| ||||||| |||| ||||||||||||||||||| |
|
|
| T |
44593552 |
cccgtgagcttaactcagttaatagagatattgcatattatatgc |
44593508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 5073264 - 5073311
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||| |||||||| ||| ||||||| ||||||||||| |
|
|
| T |
5073264 |
atccccgtgagcttaactcagttggtagagatattgtatattatatgc |
5073311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 7525441 - 7525488
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| |||| ||||||| || |||||||||||||||||||| |
|
|
| T |
7525441 |
atccccgtgagtttagttcagttggtaaggatattgcatattatatgc |
7525488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 9233835 - 9233788
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||| || |||||||| |
|
|
| T |
9233835 |
atccccgtgagcttaactcagttggtagggatattgaattttatatgc |
9233788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 10226672 - 10226719
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| |||| ||||||| ||||||| ||||||||||||||| |
|
|
| T |
10226672 |
atccccgtgagtttagttcagttggtagggatgttgcatattatatgc |
10226719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 252 - 303
Target Start/End: Original strand, 11692381 - 11692432
Alignment:
| Q |
252 |
tttcatccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||| ||||||||| || |||||||||| |||| ||||||| |
|
|
| T |
11692381 |
tttcatccccgtgagtttagctcagatggtagggatattacataatatatgc |
11692432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 260 - 303
Target Start/End: Original strand, 12264055 - 12264098
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
12264055 |
ccgtgaacttagctcagttggtagggatattgcattttatatgc |
12264098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 13720767 - 13720814
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||| |||||||||||| | ||||||||||||||||||||| |
|
|
| T |
13720767 |
atccccgtgaagttagctcagttggttgggatattgcatattatatgc |
13720814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 15694547 - 15694594
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||| ||||||||||| |
|
|
| T |
15694547 |
atccccgtgagcttaattcagttggtagggatattgtatattatatgc |
15694594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 15701527 - 15701574
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||| ||||||||||| |
|
|
| T |
15701527 |
atccccgtgagcttaattcagttggtagggatattgtatattatatgc |
15701574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 262 - 301
Target Start/End: Complemental strand, 21177705 - 21177666
Alignment:
| Q |
262 |
gtgagcttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
21177705 |
gtgagcttaactcaattgatagggatattgcatattatat |
21177666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 21762965 - 21762918
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||| |||| |||||||| || |||||||||||||||||||| |
|
|
| T |
21762965 |
atccccgtgaacttatctcagttggtaaggatattgcatattatatgc |
21762918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 23755087 - 23755040
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||| | | ||||||||||||||||| ||||| |
|
|
| T |
23755087 |
atccccgtgagcttagctcaatcggtagggatattgcatattttatgc |
23755040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 260 - 303
Target Start/End: Original strand, 24188471 - 24188514
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||| ||||||||||| |||||||| |||||||||||||| |
|
|
| T |
24188471 |
ccgtgagcatagctcagttggtagggatactgcatattatatgc |
24188514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 260 - 303
Target Start/End: Complemental strand, 24880521 - 24880478
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
24880521 |
ccgtaagcttagctcagttggtagggatattgaatattatatgc |
24880478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 26801802 - 26801755
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| ||||||||||| |||| |||||||||||||||||| |
|
|
| T |
26801802 |
atccccgtgagtatagctcagttggtaggaatattgcatattatatgc |
26801755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 27679083 - 27679036
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||| |||||||||| |||||||| || |||||||||||||||||||| |
|
|
| T |
27679083 |
atcctcgtgagcttaactcagttggtatggatattgcatattatatgc |
27679036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 27704372 - 27704325
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||| |||| |||||||| |||| |||||||||||||||||| |
|
|
| T |
27704372 |
atccccgtgaacttaactcagttggtaggaatattgcatattatatgc |
27704325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 32074468 - 32074421
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||| |||||||| |
|
|
| T |
32074468 |
atccccgtgagcttagctcagttggtagggatatcacattttatatgc |
32074421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 35645596 - 35645643
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||| ||||| ||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
35645596 |
atccccatgagcgtagctcagttggtagggatattgtatattatatgc |
35645643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 36114414 - 36114367
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||| |||||| ||||||| |||||| ||||||||||||||||| |
|
|
| T |
36114414 |
atccccgtaagcttaactcagttaataggggtattgcatattatatgc |
36114367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 260 - 303
Target Start/End: Complemental strand, 42182267 - 42182224
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| |||||||| ||||| ||||||||||||||||| |
|
|
| T |
42182267 |
ccgtgagcttaactcagttggtaggggtattgcatattatatgc |
42182224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 264 - 303
Target Start/End: Complemental strand, 43633155 - 43633116
Alignment:
| Q |
264 |
gagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43633155 |
gagcttagctcagttgatagggatattatatattatatgc |
43633116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 261 - 303
Target Start/End: Complemental strand, 10691 - 10649
Alignment:
| Q |
261 |
cgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||| ||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
10691 |
cgtgatcttagcttagttggtagggatattgcatattatatgc |
10649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 2846129 - 2846095
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcat |
294 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |
|
|
| T |
2846129 |
ccgtgaacttagctcagttgatagggatattgcat |
2846095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 256 - 302
Target Start/End: Original strand, 9497963 - 9498009
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
||||||| ||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
9497963 |
atccccgcgagtttagctcaattggtagggatattgcatattatatg |
9498009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 303
Target Start/End: Original strand, 10690857 - 10690891
Alignment:
| Q |
269 |
tagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |
|
|
| T |
10690857 |
tagctcagctgatagggatattgcatattatatgc |
10690891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 265 - 303
Target Start/End: Complemental strand, 20421823 - 20421785
Alignment:
| Q |
265 |
agcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
20421823 |
agcttagttcagttaatagggatattgcatattatatgc |
20421785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 256 - 302
Target Start/End: Original strand, 24508823 - 24508869
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
||||| |||||| ||| ||||||| |||||||||||||||||||||| |
|
|
| T |
24508823 |
atcccagtgagcgtagttcagttggtagggatattgcatattatatg |
24508869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 262 - 300
Target Start/End: Original strand, 28735731 - 28735769
Alignment:
| Q |
262 |
gtgagcttagctcagttgatagggatattgcatattata |
300 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
28735731 |
gtgagcttaactcagttggtagggatattgcatattata |
28735769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 302
Target Start/End: Original strand, 41699640 - 41699682
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
41699640 |
ccgtgagcttagctcagttagtagggatattgcatatcatatg |
41699682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 301
Target Start/End: Original strand, 3529777 - 3529822
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
||||||||||| ||| |||||||| |||||||||||||| |||||| |
|
|
| T |
3529777 |
atccccgtgagtttaactcagttggtagggatattgcattttatat |
3529822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 254 - 303
Target Start/End: Original strand, 3532573 - 3532622
Alignment:
| Q |
254 |
tcatccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||| ||||| ||||| ||||||| ||||||||||||||| ||||||| |
|
|
| T |
3532573 |
tcatcctcgtgatcttagttcagttggtagggatattgcataatatatgc |
3532622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 301
Target Start/End: Original strand, 12364746 - 12364791
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
||||||||||||||| |||| ||| ||||||||||| ||||||||| |
|
|
| T |
12364746 |
atccccgtgagcttaactcacttggtagggatattgtatattatat |
12364791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 262 - 303
Target Start/End: Complemental strand, 13730164 - 13730123
Alignment:
| Q |
262 |
gtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||| ||||| ||| ||||||||||||||||||| |
|
|
| T |
13730164 |
gtgagcttagcttagttggtagagatattgcatattatatgc |
13730123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 260 - 293
Target Start/End: Original strand, 24017986 - 24018019
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgca |
293 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
24017986 |
ccgtgagcttagctcagttgatagggataatgca |
24018019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 301
Target Start/End: Complemental strand, 25672471 - 25672426
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
||||||| ||| |||| | ||||||||||||||||||||||||||| |
|
|
| T |
25672471 |
atccccgcgagtttagtttagttgatagggatattgcatattatat |
25672426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 257 - 302
Target Start/End: Complemental strand, 37451303 - 37451258
Alignment:
| Q |
257 |
tccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||| |||||| |||||| |
|
|
| T |
37451303 |
tccccgtgagtttagctcagttgataaggataatgcataatatatg |
37451258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 257 - 302
Target Start/End: Complemental strand, 40518961 - 40518916
Alignment:
| Q |
257 |
tccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
||||||||| ||||||||||||| |||||| |||||||| |||||| |
|
|
| T |
40518961 |
tccccgtgaacttagctcagttggtagggacattgcataatatatg |
40518916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 261 - 302
Target Start/End: Original strand, 49089502 - 49089543
Alignment:
| Q |
261 |
cgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||| ||||||| |
|
|
| T |
49089502 |
cgtgagtttagctcagttgttagggatattgcatgttatatg |
49089543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 271 - 303
Target Start/End: Complemental strand, 1563797 - 1563765
Alignment:
| Q |
271 |
gctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
1563797 |
gctcagttggtagggatattgcatattatatgc |
1563765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 254 - 290
Target Start/End: Complemental strand, 6973577 - 6973541
Alignment:
| Q |
254 |
tcatccccgtgagcttagctcagttgatagggatatt |
290 |
Q |
| |
|
||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
6973577 |
tcatccccgtgagcttaactcagttggtagggatatt |
6973541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 267 - 303
Target Start/End: Original strand, 15020968 - 15021004
Alignment:
| Q |
267 |
cttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
15020968 |
cttagctcagttgataggaatattgcatgttatatgc |
15021004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 303
Target Start/End: Original strand, 15655708 - 15655748
Alignment:
| Q |
263 |
tgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||| ||| |||||||||||||| |||||||| |
|
|
| T |
15655708 |
tgagcttagctcaattggtagggatattgcattttatatgc |
15655748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 303
Target Start/End: Complemental strand, 15716751 - 15716711
Alignment:
| Q |
263 |
tgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||| |||||||||||| |||||||||||| |||||||||| |
|
|
| T |
15716751 |
tgagtttagctcagttggtagggatattgcgtattatatgc |
15716711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 255 - 303
Target Start/End: Complemental strand, 19331571 - 19331523
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||| |||||| || ||||||||||| |||||||| |
|
|
| T |
19331571 |
catccccgtgagcttagtgcagttggtacggatattgcattttatatgc |
19331523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 271 - 303
Target Start/End: Original strand, 30681424 - 30681456
Alignment:
| Q |
271 |
gctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |
|
|
| T |
30681424 |
gctcaattgatagggatattgcatattatatgc |
30681456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 259 - 303
Target Start/End: Complemental strand, 31191670 - 31191626
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||| ||||||| || |||||||||||||||||||| |
|
|
| T |
31191670 |
cccgtgagcttaattcagttggtaaggatattgcatattatatgc |
31191626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 259 - 303
Target Start/End: Complemental strand, 31769582 - 31769538
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||| | || ||||||| ||||||||||||||||||||||| |
|
|
| T |
31769582 |
cccgtgagataagttcagttggtagggatattgcatattatatgc |
31769538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #119
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 259 - 303
Target Start/End: Complemental strand, 32856987 - 32856943
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||| ||||||| | ||| ||||||||||||||||||||||| |
|
|
| T |
32856987 |
cccgtgaacttagcttaattggtagggatattgcatattatatgc |
32856943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #120
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 303
Target Start/End: Complemental strand, 35612633 - 35612593
Alignment:
| Q |
263 |
tgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||| ||| |||||| |||||||||||||||| |
|
|
| T |
35612633 |
tgagcttagctcaattggtagggagattgcatattatatgc |
35612593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #121
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 262 - 294
Target Start/End: Original strand, 38151347 - 38151379
Alignment:
| Q |
262 |
gtgagcttagctcagttgatagggatattgcat |
294 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
38151347 |
gtgagcttagctcagttggtagggatattgcat |
38151379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #122
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 259 - 303
Target Start/End: Complemental strand, 42798386 - 42798342
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||| | ||||| ||||||||||||||||||||||| |
|
|
| T |
42798386 |
cccgtgagcttaacccagtttgtagggatattgcatattatatgc |
42798342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #123
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 267 - 303
Target Start/End: Original strand, 48719807 - 48719843
Alignment:
| Q |
267 |
cttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
48719807 |
cttagctcagttggtaggaatattgcatattatatgc |
48719843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 84; Significance: 6e-40; HSPs: 103)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 3 - 231
Target Start/End: Original strand, 14042222 - 14042447
Alignment:
| Q |
3 |
tttgacaactcaagagaacttttggtatggtatgagtagaagtgagggaggggaactcaatttat-----aggtgaagaaccaaagataagttacaaatc |
97 |
Q |
| |
|
|||||||||||||| ||||||||||| || | |||||||||||||| ||| |||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
14042222 |
tttgacaactcaagggaacttttggtgtg-----aatagaagtgagggagaggagctcaatttatattataggtgaagagccaaagataagttacaaatc |
14042316 |
T |
 |
| Q |
98 |
caatggctaggattagttgaccgttagaaaatcaatggcttgatctctcatcataaatgagcacta--attgagaaagttgacaagagannnnnnnnnnn |
195 |
Q |
| |
|
| || |||||||||||||||||||| ||||||||||||||||| || |||||||||||||||||| |||||||||||||| | ||| |
|
|
| T |
14042317 |
cgatagctaggattagttgaccgttggaaaatcaatggcttga--tcgcatcataaatgagcactaatattgagaaagttgatacaaga---attttttt |
14042411 |
T |
 |
| Q |
196 |
aattcacaccataacactccatgtgttccaacagtt |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
14042412 |
aattcacaccataacactccatgtgttccaacagtt |
14042447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 2 - 178
Target Start/End: Original strand, 35130203 - 35130373
Alignment:
| Q |
2 |
atttgacaactcaagagaacttttggtatggtatgagtagaagtgagggaggggaactcaatttataggtgaagaaccaaagataagttacaaatccaat |
101 |
Q |
| |
|
|||||||||||||||||||||||||| ||| |||||||||||||||| ||| ||| ||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
35130203 |
atttgacaactcaagagaacttttgggatg-----agtagaagtgagggagaggagctctatttataggtgaagagtcaaagatgagttacaaatccaat |
35130297 |
T |
 |
| Q |
102 |
ggctaggattagttgaccgttagaaaatcaatggcttgatctctcatcataaatgagcactaattgagaaagttgac |
178 |
Q |
| |
|
| ||||||||||||||| || ||||||||| | |||| |||| ||||||||||||||| | ||||| ||||||| |
|
|
| T |
35130298 |
gactaggattagttgacatcta-caaatcaatgacatgatttctcctcataaatgagcactcaatgagatagttgac |
35130373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 3 - 160
Target Start/End: Complemental strand, 32814587 - 32814435
Alignment:
| Q |
3 |
tttgacaactcaagagaacttttggtatggtatgagtagaagtgagggaggggaactcaatttataggtgaagaaccaaagataagttacaaatccaatg |
102 |
Q |
| |
|
||||| ||||||||||||||||||| ||| |||||||| |||| ||| ||| ||||||||||||||||||| |||||||||||||||||||||| || |
|
|
| T |
32814587 |
tttgataactcaagagaacttttgg---ggt--gagtagaattgagtgagaggagctcaatttataggtgaagagccaaagataagttacaaatccattg |
32814493 |
T |
 |
| Q |
103 |
gctaggattagttgaccgttagaaaatcaatggcttgatctctcatcataaatgagca |
160 |
Q |
| |
|
||||||||||||||||| | |||||||||| | |||| | || |||||||| |||| |
|
|
| T |
32814492 |
gctaggattagttgaccaccacaaaatcaatgacatgatatttcctcataaataagca |
32814435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 79 - 228
Target Start/End: Complemental strand, 29610224 - 29610086
Alignment:
| Q |
79 |
caaagataagttacaaatccaatggctaggattagttgaccgttagaaaatcaatggcttgatctctcatcataaatgagcactaattgagaaagttgac |
178 |
Q |
| |
|
|||| |||||||||||||||||||||||| | |||||||||||||||| ||||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
29610224 |
caaatataagttacaaatccaatggctagaa--------ccgttagaaaatcaataacttgatctcgcctcataaatgagcactaattgagaaagttgac |
29610133 |
T |
 |
| Q |
179 |
aagagannnnnnnnnnnaattcacaccataacactccatgtgttccaaca |
228 |
Q |
| |
|
| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
29610132 |
atgaga---ttttttttaattcacaccataacactccatgtgttccaaca |
29610086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 3 - 162
Target Start/End: Original strand, 14776121 - 14776275
Alignment:
| Q |
3 |
tttgacaactcaagagaacttttggtatggtatgagtagaagtgagggaggggaactcaatttataggtgaagaaccaaagataagttacaaatccaatg |
102 |
Q |
| |
|
|||||||||||||||||||||||||| || | |||||||||| | | || ||| |||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
14776121 |
tttgacaactcaagagaacttttggtgtgcaa-----agaagtgaggaatgtgagctcttcttataggtgaggagccaaagataagttacaaatccaatg |
14776215 |
T |
 |
| Q |
103 |
gctaggattagttgaccgttagaaaatcaatggcttgatctctcatcataaatgagcact |
162 |
Q |
| |
|
| |||||||||||||||| |||||| ||| | ||||||| | ||||||||||||||| |
|
|
| T |
14776216 |
gttaggattagttgaccgccggaaaattaataacatgatctcgcctcataaatgagcact |
14776275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 252 - 303
Target Start/End: Original strand, 607180 - 607231
Alignment:
| Q |
252 |
tttcatccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
607180 |
tttcatccccgtgagcttagctcagttggtagggatattgcatattatatgc |
607231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 253 - 303
Target Start/End: Original strand, 7207838 - 7207888
Alignment:
| Q |
253 |
ttcatccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7207838 |
ttcatccccgtgagcttagctcagttggtagggatattgcatattatatgc |
7207888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 3794246 - 3794199
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3794246 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
3794199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 4408355 - 4408402
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4408355 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
4408402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 7545326 - 7545373
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7545326 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
7545373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 7865428 - 7865381
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7865428 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
7865381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 9246455 - 9246408
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9246455 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
9246408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 9372274 - 9372227
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9372274 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
9372227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 9435623 - 9435670
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9435623 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
9435670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 10934596 - 10934643
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10934596 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
10934643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 15091445 - 15091492
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
15091445 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
15091492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 17441912 - 17441865
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
17441912 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
17441865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 19953901 - 19953854
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19953901 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
19953854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 33573814 - 33573861
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33573814 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
33573861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 253 - 303
Target Start/End: Complemental strand, 33697189 - 33697139
Alignment:
| Q |
253 |
ttcatccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
33697189 |
ttcatccccgtgagcttaactcagttgatagggatattgcattttatatgc |
33697139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 256 - 301
Target Start/End: Complemental strand, 30885643 - 30885598
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30885643 |
atccccgtgagcttagctcagttggtagggatattgcatattatat |
30885598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 255 - 303
Target Start/End: Original strand, 4661092 - 4661140
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
4661092 |
catccccgtgagcttagcttagttggtagggatattgcatattatatgc |
4661140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 259 - 303
Target Start/End: Original strand, 8439675 - 8439719
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8439675 |
cccgtgagcttagctcagttggtagggatattgcatattatatgc |
8439719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 18038912 - 18038837
Alignment:
| Q |
108 |
gattagttgaccgttagaaaatcaatggcttgatctctcatcataaatgagcactaattgagaaagttgacaagaga |
184 |
Q |
| |
|
|||||||||| | |||||||||||||||||| |||| ||||||||||||||||||| |||||||| ||||| |||| |
|
|
| T |
18038912 |
gattagttgatc-ttagaaaatcaatggcttaatctaacatcataaatgagcactaactgagaaagctgacatgaga |
18038837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 255 - 303
Target Start/End: Complemental strand, 27094881 - 27094833
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
27094881 |
catccccgtgagcttaactcagttggtagggatattgcatattatatgc |
27094833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 1968993 - 1969040
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
1968993 |
atccccgtgagcttagctcagttggtagggatattacatattatatgc |
1969040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 260 - 303
Target Start/End: Original strand, 3294765 - 3294808
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3294765 |
ccgtgagcttagctcagttggtagggatattgcatattatatgc |
3294808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 6210051 - 6210098
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6210051 |
atccccgtgaacttagctcagttggtagggatattgcatattatatgc |
6210098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 8857087 - 8857134
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
8857087 |
atccccgtgagcttagctcagttggtagggatattacatattatatgc |
8857134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 9704414 - 9704461
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9704414 |
atccccgtgaacttagctcagttggtagggatattgcatattatatgc |
9704461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 13732809 - 13732856
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
13732809 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgc |
13732856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 259 - 302
Target Start/End: Original strand, 27218884 - 27218927
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
27218884 |
cccgtgaccttagctcagttgatagggatattgcatattatatg |
27218927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 28030861 - 28030908
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28030861 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgc |
28030908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 31104879 - 31104926
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
31104879 |
atccccgtgagcttagttcagttgatagggatattacatattatatgc |
31104926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 31802050 - 31802097
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
31802050 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgc |
31802097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 256 - 302
Target Start/End: Complemental strand, 19892349 - 19892303
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
19892349 |
atccccgtgagcttagttcagttggtagggatattgcatattatatg |
19892303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 256 - 302
Target Start/End: Original strand, 29284263 - 29284309
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
29284263 |
atccccgtgagtttagctcagttggtagggatattgcatattatatg |
29284309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 258 - 303
Target Start/End: Original strand, 2251837 - 2251882
Alignment:
| Q |
258 |
ccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
2251837 |
ccccgtgagcttagctcagttggtagggatattgcatactatatgc |
2251882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 254 - 303
Target Start/End: Complemental strand, 28148808 - 28148759
Alignment:
| Q |
254 |
tcatccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||| ||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28148808 |
tcatccccttgaacttagctcagttggtagggatattgcatattatatgc |
28148759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 255 - 303
Target Start/End: Complemental strand, 978208 - 978160
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
978208 |
catccccgtgagtttagctcagttagtagggatattgcatattatatgc |
978160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 259 - 303
Target Start/End: Complemental strand, 4869768 - 4869724
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
4869768 |
cccgtgagcttagctcagttggtagggatactgcatattatatgc |
4869724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 259 - 303
Target Start/End: Original strand, 32166369 - 32166413
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
32166369 |
cccgtgagcttagctcaattggtagggatattgcatattatatgc |
32166413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 263 - 303
Target Start/End: Complemental strand, 32611620 - 32611580
Alignment:
| Q |
263 |
tgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32611620 |
tgagcttagctcagttggtagggatattgcatattatatgc |
32611580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 255 - 303
Target Start/End: Complemental strand, 32813724 - 32813676
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||| ||||||| || |||||||||||||||||||| |
|
|
| T |
32813724 |
catccccgtgagcttagttcagttggtacggatattgcatattatatgc |
32813676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 259 - 303
Target Start/End: Complemental strand, 34432867 - 34432823
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
34432867 |
cccgtgagcttagttcagttggtagggatattgcatattatatgc |
34432823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 3640511 - 3640558
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
3640511 |
atcctcgtgagcttagctcagttggtagggatattgcatagtatatgc |
3640558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 7177292 - 7177339
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| || |||||||| |
|
|
| T |
7177292 |
atccccgtgagcttagctcagttggtagggatattgtattttatatgc |
7177339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 10483609 - 10483562
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
10483609 |
atccccgtgatcttagctcagttggtagggatattgcattttatatgc |
10483562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 10517196 - 10517243
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||||| |||||||| |
|
|
| T |
10517196 |
atccccgtgagcttagctcagttggtatggatattgcattttatatgc |
10517243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 17454818 - 17454771
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||| |||||||| ||| ||||||||||||||||||| |
|
|
| T |
17454818 |
atccccgtgagcttatctcagttggtagagatattgcatattatatgc |
17454771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 19374913 - 19374866
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
19374913 |
atccccgtgagcttagctcagttagtaggaatattgcatattatatgc |
19374866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 22574867 - 22574914
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||| |||||||| |
|
|
| T |
22574867 |
atccccgtgagcttagctcagttggtagggatatcgcattttatatgc |
22574914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 28237325 - 28237278
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||| |||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
28237325 |
atcctcgtgagcttaactcagttggtagggatattgcatattatatgc |
28237278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 261 - 303
Target Start/End: Original strand, 743565 - 743607
Alignment:
| Q |
261 |
cgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
743565 |
cgtgagcttagctcagttggtagggatattgcatattagatgc |
743607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 259 - 301
Target Start/End: Original strand, 3196619 - 3196661
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
3196619 |
cccgtgagcttagctcagttggtagggatattacatattatat |
3196661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 261 - 303
Target Start/End: Original strand, 7414331 - 7414373
Alignment:
| Q |
261 |
cgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
7414331 |
cgtgagcttggctcagttggtagggatattgcatattatatgc |
7414373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 255 - 301
Target Start/End: Original strand, 20584069 - 20584115
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
|||||| ||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
20584069 |
catccctgtgagcttaactcagttgatagcgatattgcatattatat |
20584115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 256 - 302
Target Start/End: Original strand, 21248529 - 21248575
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
21248529 |
atccccgtaagcttagctcagttggtagggatattgcattttatatg |
21248575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 260 - 302
Target Start/End: Original strand, 22997337 - 22997379
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
22997337 |
ccgtgagcttagctcagttggtagggatattgaatattatatg |
22997379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 260 - 302
Target Start/End: Complemental strand, 23791064 - 23791022
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
23791064 |
ccgtgagcttagctcagttggtagggatattgaatattatatg |
23791022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 256 - 302
Target Start/End: Original strand, 30704957 - 30705003
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||| ||||||| |
|
|
| T |
30704957 |
atccccgtgagcttagttcagttggtagggatattgcatgttatatg |
30705003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 262 - 303
Target Start/End: Original strand, 361166 - 361207
Alignment:
| Q |
262 |
gtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
361166 |
gtgagcttaactcagttggtagggatattgcatattatatgc |
361207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 254 - 303
Target Start/End: Complemental strand, 15964017 - 15963969
Alignment:
| Q |
254 |
tcatccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
15964017 |
tcatcccc-tgagcttagctcagttggtagggatattgcatattttatgc |
15963969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 262 - 303
Target Start/End: Original strand, 31935102 - 31935143
Alignment:
| Q |
262 |
gtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
31935102 |
gtgagcttagctcagttggtagggatattgcattttatatgc |
31935143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 261 - 302
Target Start/End: Original strand, 32837344 - 32837385
Alignment:
| Q |
261 |
cgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
32837344 |
cgtgagcttagctcagttgctagggatattacatattatatg |
32837385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 254 - 302
Target Start/End: Complemental strand, 2801715 - 2801668
Alignment:
| Q |
254 |
tcatccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
||||||||||||| |||||| |||| ||||||||||||||||||||||| |
|
|
| T |
2801715 |
tcatccccgtgagtttagcttagtt-atagggatattgcatattatatg |
2801668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 251 - 303
Target Start/End: Original strand, 2816882 - 2816934
Alignment:
| Q |
251 |
gtttcatccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||| |||||| ||||||||||||| ||| |||||||||||||| |||||||| |
|
|
| T |
2816882 |
gtttgatccccatgagcttagctcaattggtagggatattgcatgttatatgc |
2816934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 255 - 303
Target Start/End: Original strand, 10628610 - 10628658
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||| ||||||| ||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
10628610 |
catctccgtgagtttagctcggttggtagggatattgcatattatatgc |
10628658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 303
Target Start/End: Original strand, 11301371 - 11301411
Alignment:
| Q |
263 |
tgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
11301371 |
tgagcatagctcagttgataggaatattgcatattatatgc |
11301411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 255 - 303
Target Start/End: Complemental strand, 26557380 - 26557332
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||| | ||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
26557380 |
catccccgtaaacttagctcagttgattgagatattgcatattatatgc |
26557332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 259 - 303
Target Start/End: Original strand, 28222863 - 28222907
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||| |||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
28222863 |
cccgtgaacttaactcagttggtagggatattgcatattatatgc |
28222907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 256 - 292
Target Start/End: Complemental strand, 30391293 - 30391257
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgc |
292 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
30391293 |
atccccgtgagcttagctcagttgttagggatattgc |
30391257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 259 - 303
Target Start/End: Complemental strand, 32050035 - 32049991
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||| ||||| || ||||||||||||||||||||||| |
|
|
| T |
32050035 |
cccgtgagcttaactcagctggtagggatattgcatattatatgc |
32049991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 12077 - 12030
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| |||||||||||||||| |||| |||||| ||||||| |
|
|
| T |
12077 |
atccccgtgagtttagctcagttgatagagataatgcataatatatgc |
12030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 216203 - 216250
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||| |||||||||||||| ||| |||||||||||||| |||||||| |
|
|
| T |
216203 |
atcccagtgagcttagctcaattggtagggatattgcatgttatatgc |
216250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 260 - 303
Target Start/End: Original strand, 492903 - 492946
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
492903 |
ccgtgagcttagctcagttggcaaggatattgcatattatatgc |
492946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 268 - 303
Target Start/End: Complemental strand, 3795835 - 3795800
Alignment:
| Q |
268 |
ttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3795835 |
ttagctcagttggtagggatattgcatattatatgc |
3795800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 5052146 - 5052099
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||| |||| |||||||| |
|
|
| T |
5052146 |
atccccgtgagcttagctcaattggtagggatatcgcattttatatgc |
5052099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 6419155 - 6419108
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| ||| |||||||| ||| ||||||||||||||||||| |
|
|
| T |
6419155 |
atccccgtgagtttaactcagttggtagagatattgcatattatatgc |
6419108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 7581041 - 7581088
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||| || || |||||||||||||| |||||||| |
|
|
| T |
7581041 |
atccccgtgagcttagcttagctggtagggatattgcattttatatgc |
7581088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 8297624 - 8297671
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||| |||||| |||||||| |
|
|
| T |
8297624 |
atccccgtgagcttagctcaattggtagggatgttgcatgttatatgc |
8297671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 260 - 303
Target Start/End: Original strand, 12284122 - 12284165
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| ||||||||||| |
|
|
| T |
12284122 |
ccgtgagcttaactcagttggtagggatattgaatattatatgc |
12284165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 268 - 303
Target Start/End: Complemental strand, 16966455 - 16966420
Alignment:
| Q |
268 |
ttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16966455 |
ttagctcagttggtagggatattgcatattatatgc |
16966420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 258 - 301
Target Start/End: Complemental strand, 19618799 - 19618756
Alignment:
| Q |
258 |
ccccgtgagcttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
||||||||| |||||||| ||| ||||||||||||||||||||| |
|
|
| T |
19618799 |
ccccgtgagtttagctcaattggtagggatattgcatattatat |
19618756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 259 - 302
Target Start/End: Original strand, 21203038 - 21203081
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||||||| ||||| |
|
|
| T |
21203038 |
cccgtgagtttagctcagttggtagggatattgcatatcatatg |
21203081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 29733625 - 29733672
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||| ||||||||||||| || ||||||| |||||||||||| |
|
|
| T |
29733625 |
atccccgtgaacttagctcagttggtacggatattacatattatatgc |
29733672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 267 - 302
Target Start/End: Original strand, 34040681 - 34040716
Alignment:
| Q |
267 |
cttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |
|
|
| T |
34040681 |
cttagctcagttgatagggatattgtatattatatg |
34040716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 302
Target Start/End: Complemental strand, 2500583 - 2500541
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
||||| |||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
2500583 |
ccgtgtgcttagcttagttggtagggatattgcatattatatg |
2500541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #89
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 261 - 303
Target Start/End: Original strand, 7418280 - 7418322
Alignment:
| Q |
261 |
cgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||| |||| ||| ||||||||||||||||||||||| |
|
|
| T |
7418280 |
cgtgagcttaactcatttggtagggatattgcatattatatgc |
7418322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #90
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 303
Target Start/End: Complemental strand, 10501199 - 10501165
Alignment:
| Q |
269 |
tagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10501199 |
tagctcagttggtagggatattgcatattatatgc |
10501165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #91
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 257 - 303
Target Start/End: Complemental strand, 20568357 - 20568311
Alignment:
| Q |
257 |
tccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||||| || ||| |||||||| ||||||| |
|
|
| T |
20568357 |
tccccgtgagcttagctcagttggtaaggacattgcataatatatgc |
20568311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #92
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 257 - 303
Target Start/End: Complemental strand, 24956912 - 24956866
Alignment:
| Q |
257 |
tccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||| |||||||||||||||||||| | |||||||| ||||| |
|
|
| T |
24956912 |
tccccgtgatcttagctcagttgatagggacaatgcatattttatgc |
24956866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #93
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 256 - 294
Target Start/End: Original strand, 31705896 - 31705934
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcat |
294 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
31705896 |
atccccgtgagcttagctcagttggtatggatattgcat |
31705934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #94
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 260 - 301
Target Start/End: Complemental strand, 2688648 - 2688607
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
|||| ||||||||||||||| || |||||||||||||||||| |
|
|
| T |
2688648 |
ccgttagcttagctcagttggtaaggatattgcatattatat |
2688607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #95
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 260 - 301
Target Start/End: Complemental strand, 7328716 - 7328675
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||| |||||| |
|
|
| T |
7328716 |
ccgtgagcttaactcagttggtagggatattgcattttatat |
7328675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #96
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 261 - 302
Target Start/End: Original strand, 29069482 - 29069523
Alignment:
| Q |
261 |
cgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||| |||||| |
|
|
| T |
29069482 |
cgtgagcttagctcagttgatagggacaatgcataatatatg |
29069523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #97
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 259 - 303
Target Start/End: Complemental strand, 1100309 - 1100265
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||| ||||||||||||| ||||||||| |||| |||||||| |
|
|
| T |
1100309 |
cccgtgaacttagctcagttggtagggatatagcattttatatgc |
1100265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #98
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 259 - 303
Target Start/End: Complemental strand, 3299037 - 3298993
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||| ||| ||| |||||||||||||||| |||||| |
|
|
| T |
3299037 |
cccgtgagcttagatcaattggtagggatattgcatataatatgc |
3298993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #99
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 303
Target Start/End: Original strand, 7153792 - 7153832
Alignment:
| Q |
263 |
tgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||| |||||||| |||||||||||||| |||||||| |
|
|
| T |
7153792 |
tgagcttaactcagttggtagggatattgcatgttatatgc |
7153832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #100
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 256 - 300
Target Start/End: Complemental strand, 7470802 - 7470758
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattata |
300 |
Q |
| |
|
|||| ||| ||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
7470802 |
atcctcgtaagcttagctcagttggtagggataatgcatattata |
7470758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #101
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 255 - 303
Target Start/End: Complemental strand, 14579360 - 14579312
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||| |||||| | ||| ||||||||||||| ||||||||| |
|
|
| T |
14579360 |
catccccgtgagtttagcttatttggtagggatattgcaaattatatgc |
14579312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #102
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 258 - 302
Target Start/End: Original strand, 26347403 - 26347447
Alignment:
| Q |
258 |
ccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||| ||||||||||||| ||| ||||||| |||||||||| |
|
|
| T |
26347403 |
ccccgtgaacttagctcagttggtagagatattgtatattatatg |
26347447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #103
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 303
Target Start/End: Complemental strand, 30700257 - 30700217
Alignment:
| Q |
263 |
tgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||| |||||||| || |||||||||||||||||||| |
|
|
| T |
30700257 |
tgagcttaactcagttggtacggatattgcatattatatgc |
30700217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 83; Significance: 2e-39; HSPs: 157)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 3 - 162
Target Start/End: Original strand, 19950397 - 19950551
Alignment:
| Q |
3 |
tttgacaactcaagagaacttttggtatggtatgagtagaagtgagggaggggaactcaatttataggtgaagaaccaaagataagttacaaatccaatg |
102 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||||||||||||| ||||||| ||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
19950397 |
tttgacaactcaagagaacttttga---ggt--gagtagaagtgagggagaggaactctatttataggtgaagagccaaagatgagttacaaatccaatg |
19950491 |
T |
 |
| Q |
103 |
gctaggattagttgaccgttagaaaatcaatggcttgatctctcatcataaatgagcact |
162 |
Q |
| |
|
|||| |||||||||||| || |||||||||| | |||| |||| ||||||||||||||| |
|
|
| T |
19950492 |
gctatgattagttgacctctacaaaatcaatgacatgatttctcctcataaatgagcact |
19950551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 3 - 162
Target Start/End: Original strand, 19954851 - 19955005
Alignment:
| Q |
3 |
tttgacaactcaagagaacttttggtatggtatgagtagaagtgagggaggggaactcaatttataggtgaagaaccaaagataagttacaaatccaatg |
102 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||||||||| ||||| ||||||| ||||||| ||||||| |||||||| ||||||||||||| || |
|
|
| T |
19954851 |
tttgacaactcaagagaacttttgg---ggt--gagtagaagtgtgggagaggaactctatttataagtgaagagccaaagatgagttacaaatccattg |
19954945 |
T |
 |
| Q |
103 |
gctaggattagttgaccgttagaaaatcaatggcttgatctctcatcataaatgagcact |
162 |
Q |
| |
|
||||||||||||||||| || |||||||||| | |||| | || ||||||||||||||| |
|
|
| T |
19954946 |
gctaggattagttgacctctacaaaatcaatgacatgatttatcctcataaatgagcact |
19955005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 3 - 184
Target Start/End: Original strand, 2470555 - 2470731
Alignment:
| Q |
3 |
tttgacaactcaagagaacttttggtatggtatgagtagaagtgagggaggggaactcaatttataggtgaagaaccaaagataagttacaaatccaatg |
102 |
Q |
| |
|
||||||||||||||| ||||||||| || |||||||||||||||| ||| ||| ||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
2470555 |
tttgacaactcaagataacttttgggatc-----agtagaagtgagggagaggagctctatttataggtgaagagccaaagatgagttacaaatccaatg |
2470649 |
T |
 |
| Q |
103 |
gctaggattagttgaccgttagaaaatcaatggcttgatctctcatcataaatgagcactaattgagaaagttgacaagaga |
184 |
Q |
| |
|
||||||||||| ||||| || |||||||||| | || |||| |||||||||| |||| | || || |||||||| |||| |
|
|
| T |
2470650 |
gctaggattagctgacctctacaaaatcaatgacaaaatttctcctcataaatgaacactcaatgtgatagttgacatgaga |
2470731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 133412 - 133459
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
133412 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
133459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 2792776 - 2792823
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2792776 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
2792823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 26567321 - 26567274
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26567321 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
26567274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 253 - 303
Target Start/End: Original strand, 35939481 - 35939531
Alignment:
| Q |
253 |
ttcatccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35939481 |
ttcatccccgtgagcttagctcagttggtagggatattgcatattatatgc |
35939531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 61 - 129
Target Start/End: Original strand, 30779477 - 30779545
Alignment:
| Q |
61 |
aatttataggtgaagaaccaaagataagttacaaatccaatggctaggattagttgaccgttagaaaat |
129 |
Q |
| |
|
|||||||||| || || ||||||||||||||||||||||||| ||| |||| ||||||||||||||||| |
|
|
| T |
30779477 |
aatttataggcgaggagccaaagataagttacaaatccaatgactatgattggttgaccgttagaaaat |
30779545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 12298 - 12251
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
12298 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
12251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 94584 - 94537
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
94584 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
94537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 1937307 - 1937354
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1937307 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
1937354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 1 - 162
Target Start/End: Original strand, 7146392 - 7146550
Alignment:
| Q |
1 |
tatttgacaactcaagagaacttttggtatggtatgagtagaagtgagggaggggaactcaatttataggtgaagaaccaaagataagttacaaatccaa |
100 |
Q |
| |
|
||||||||||||||| ||||||||||| ||| ||||| ||| || | | | |||||| ||||||||| || || ||||||||||||||||||||||| |
|
|
| T |
7146392 |
tatttgacaactcaaaagaacttttgg---ggt--gagtaaaagcgaagaatgagaactctatttataggcgaggagccaaagataagttacaaatccaa |
7146486 |
T |
 |
| Q |
101 |
tggc--taggattagttgaccgttagaaaatcaatggcttgatctctcatcataaatgagcact |
162 |
Q |
| |
|
|| | |||||||| |||||| || |||||||||| | ||||||| | ||||||| ||||||| |
|
|
| T |
7146487 |
tgactataggattaattgaccactacaaaatcaatgtcgtgatctcgcctcataaacgagcact |
7146550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 8265265 - 8265312
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8265265 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
8265312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 10736947 - 10736900
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10736947 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
10736900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 11875883 - 11875930
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11875883 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
11875930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 11890890 - 11890937
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11890890 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
11890937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 16449122 - 16449169
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16449122 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
16449169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 17027953 - 17027906
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
17027953 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
17027906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 17558389 - 17558342
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
17558389 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
17558342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 17698519 - 17698566
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
17698519 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
17698566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 20540179 - 20540132
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
20540179 |
atccccgtgagcttagctcagttgttagggatattgcatattatatgc |
20540132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 23435306 - 23435259
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23435306 |
atccctgtgagcttagctcagttgatagggatattgcatattatatgc |
23435259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 26022244 - 26022291
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26022244 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
26022291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 29716857 - 29716904
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29716857 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
29716904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 30972890 - 30972843
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30972890 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
30972843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 32719680 - 32719633
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32719680 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
32719633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 34413059 - 34413106
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34413059 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
34413106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 39362262 - 39362309
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39362262 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
39362309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 41689879 - 41689926
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41689879 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
41689926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 257 - 303
Target Start/End: Complemental strand, 23178963 - 23178917
Alignment:
| Q |
257 |
tccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23178963 |
tccccgtgagcttagctcagttggtagggatattgcatattatatgc |
23178917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 256 - 302
Target Start/End: Original strand, 43656033 - 43656079
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
43656033 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
43656079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 254 - 303
Target Start/End: Original strand, 23858192 - 23858241
Alignment:
| Q |
254 |
tcatccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23858192 |
tcatctccgtgagcttagctcagttggtagggatattgcatattatatgc |
23858241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 255 - 300
Target Start/End: Complemental strand, 44340419 - 44340374
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattata |
300 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
44340419 |
catccccgtgagcttagctcagttggtagggatattgcatattata |
44340374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 255 - 303
Target Start/End: Original strand, 6280476 - 6280524
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
6280476 |
catccccgtgagcttagctcagttggtagggatattgaatattatatgc |
6280524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 255 - 303
Target Start/End: Original strand, 33617968 - 33618016
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
33617968 |
catccccgtgagcttaactcagttggtagggatattgcatattatatgc |
33618016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 259 - 303
Target Start/End: Complemental strand, 34158727 - 34158683
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34158727 |
cccgtgagcttagctcagttggtagggatattgcatattatatgc |
34158683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 260 - 303
Target Start/End: Complemental strand, 2787150 - 2787107
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2787150 |
ccgtgagcttagctcagttggtagggatattgcatattatatgc |
2787107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 6659286 - 6659333
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6659286 |
atccccgtgagattagctcagttggtagggatattgcatattatatgc |
6659333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 6739688 - 6739735
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6739688 |
atccccgtgagattagctcagttggtagggatattgcatattatatgc |
6739735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 8034485 - 8034438
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
8034485 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgc |
8034438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 14876675 - 14876628
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
14876675 |
atccccgtgagcttagctcagttggtagggaaattgcatattatatgc |
14876628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 28909462 - 28909509
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
28909462 |
atccccgtgagcttagctcagttggtagggatattgcatattacatgc |
28909509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 29514623 - 29514670
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
29514623 |
atccccgtgagcttagctcagttggtagggatattgtatattatatgc |
29514670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 34266009 - 34266056
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34266009 |
atccccgcgagcttagctcagttggtagggatattgcatattatatgc |
34266056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 34894366 - 34894413
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34894366 |
atccccgtaagcttagctcagttggtagggatattgcatattatatgc |
34894413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 37717360 - 37717407
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
37717360 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgc |
37717407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 38219641 - 38219594
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38219641 |
atccccgtgagcatagctcagttggtagggatattgcatattatatgc |
38219594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 255 - 302
Target Start/End: Original strand, 42880944 - 42880991
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
42880944 |
catccccgtgagcttaactcagttggtagggatattgcatattatatg |
42880991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 43284039 - 43283992
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43284039 |
atccccgtgagtttagctcagttggtagggatattgcatattatatgc |
43283992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 253 - 303
Target Start/End: Original strand, 28628659 - 28628709
Alignment:
| Q |
253 |
ttcatccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||||||||| || ||||||| |||||||||||| |
|
|
| T |
28628659 |
ttcatccccgtgagcttagctcagttggtacggatattacatattatatgc |
28628709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 261 - 302
Target Start/End: Complemental strand, 8698648 - 8698607
Alignment:
| Q |
261 |
cgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8698648 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
8698607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 254 - 303
Target Start/End: Complemental strand, 9187298 - 9187249
Alignment:
| Q |
254 |
tcatccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||| |||||||| |
|
|
| T |
9187298 |
tcatccccgtgagcttagctcagttggtagggatattacattttatatgc |
9187249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 262 - 303
Target Start/End: Complemental strand, 27077164 - 27077123
Alignment:
| Q |
262 |
gtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27077164 |
gtgagcttagctcagttggtagggatattgcatattatatgc |
27077123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 256 - 297
Target Start/End: Complemental strand, 38745352 - 38745311
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatatt |
297 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
38745352 |
atccccgtgagcttagctcagttggtagggatattgcatatt |
38745311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 262 - 303
Target Start/End: Original strand, 42006781 - 42006822
Alignment:
| Q |
262 |
gtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42006781 |
gtgagcttagctcagttggtagggatattgcatattatatgc |
42006822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 263 - 303
Target Start/End: Complemental strand, 4654176 - 4654136
Alignment:
| Q |
263 |
tgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4654176 |
tgagcttagctcagttgctagggatattgcatattatatgc |
4654136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 259 - 303
Target Start/End: Complemental strand, 10587347 - 10587303
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10587347 |
cccgtaagcttagctcagttggtagggatattgcatattatatgc |
10587303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 259 - 303
Target Start/End: Original strand, 34472297 - 34472341
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
34472297 |
cccgtgagcttaactcagttggtagggatattgcatattatatgc |
34472341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 259 - 303
Target Start/End: Original strand, 37290922 - 37290966
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
37290922 |
cccgtgagcttaacttagttgatagggatattgcatattatatgc |
37290966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 255 - 303
Target Start/End: Complemental strand, 38620415 - 38620367
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||| |||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
38620415 |
catccctgtgagcttagctcagttggtagggatattgtatattatatgc |
38620367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 259 - 303
Target Start/End: Original strand, 40094885 - 40094929
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
40094885 |
cccgtgagcttagctcagttgataaggatattgcattttatatgc |
40094929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 259 - 303
Target Start/End: Original strand, 40362048 - 40362092
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40362048 |
cccgtgagcttagctcagttagtagggatattgcatattatatgc |
40362092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 259 - 303
Target Start/End: Original strand, 40740525 - 40740569
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
40740525 |
cccgtaagcttaactcagttgatagggatattgcatattatatgc |
40740569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 257536 - 257583
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||| |||||||| |
|
|
| T |
257536 |
atccccgtgagcttagctcagttggtagggatatcgcattttatatgc |
257583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 658384 - 658337
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||| |||||||| |
|
|
| T |
658384 |
atccccgtgagcttagctcagttggtagggatatcgcattttatatgc |
658337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 844120 - 844073
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||| |||||||| |
|
|
| T |
844120 |
atccccgtgagcttagctcagttggtagggatatcgcattttatatgc |
844073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 2294172 - 2294125
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||| |||||||||||| |
|
|
| T |
2294172 |
atccccgtgagtttagctcaattgatagggatattacatattatatgc |
2294125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 3190022 - 3189975
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||| || ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3190022 |
atccccgtgtgcatagctcagttggtagggatattgcatattatatgc |
3189975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 5326243 - 5326196
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||||| |||||||| |
|
|
| T |
5326243 |
atccccgtgagcttagctcagttggtagagatattgcattttatatgc |
5326196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 5328640 - 5328593
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||| || ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5328640 |
atccctgtaagcttagctcagttggtagggatattgcatattatatgc |
5328593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 7388452 - 7388499
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||| |||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
7388452 |
atccccgtgaacttaactcagttggtagggatattgcatattatatgc |
7388499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 7797127 - 7797174
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
7797127 |
atccccgtaagcttagctcagttggtagggatattgaatattatatgc |
7797174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 7816400 - 7816447
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
7816400 |
atccccgtaagcttagctcagttggtagggatattgaatattatatgc |
7816447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 260 - 303
Target Start/End: Original strand, 10083164 - 10083207
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
10083164 |
ccgtgagcttaactcagttggtagggatattgcatattatatgc |
10083207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 10200754 - 10200707
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||| ||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
10200754 |
atcctcgtgagcttagctcagttggtagagatattgcatattatatgc |
10200707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 10568082 - 10568129
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||||||| |||| |
|
|
| T |
10568082 |
atccccgtgagtttagctcagttggtagggatattgcatattaaatgc |
10568129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 260 - 303
Target Start/End: Original strand, 13406601 - 13406644
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
13406601 |
ccgtgagcttaactcagttggtagggatattgcatattatatgc |
13406644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 260 - 303
Target Start/End: Complemental strand, 16432197 - 16432154
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16432197 |
ccgtgaacttagctcagttggtagggatattgcatattatatgc |
16432154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 17072636 - 17072589
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||| |||||| |||| |||||||||||||||||| |
|
|
| T |
17072636 |
atccccgtgagcttagcacagttggtaggtatattgcatattatatgc |
17072589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 17575635 - 17575682
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||| |||||| |||| |||||||||||||||||| |
|
|
| T |
17575635 |
atccccgtgagcttagcacagttggtaggtatattgcatattatatgc |
17575682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 260 - 303
Target Start/End: Complemental strand, 24296937 - 24296894
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24296937 |
ccgtgagcttagctcagttagtagggatattgcatattatatgc |
24296894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 24458314 - 24458361
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
24458314 |
atccccgtgagcttagctcagttggaagggatattgtatattatatgc |
24458361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 26280857 - 26280810
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||| |||||||| |
|
|
| T |
26280857 |
atccccgtgagcttaactcagttggtagggatattgcattttatatgc |
26280810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 28420497 - 28420450
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||| ||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
28420497 |
atcctcgtgagcttagctcagttggtaggaatattgcatattatatgc |
28420450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 260 - 303
Target Start/End: Complemental strand, 31451026 - 31450983
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
31451026 |
ccgtgagcttaactcagttggtagggatattgcatattatatgc |
31450983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 36540284 - 36540331
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||| |||||||| |
|
|
| T |
36540284 |
atccccgtgagcttaactcagttggtagggatattgcattttatatgc |
36540331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 37092088 - 37092135
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
37092088 |
atccccgtgagtttagctcagttggtagggatattgtatattatatgc |
37092135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 38955267 - 38955220
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||| |||||||||||| |
|
|
| T |
38955267 |
atccccgtgagcttaactcagttggtagggatattacatattatatgc |
38955220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 254 - 301
Target Start/End: Original strand, 39587542 - 39587589
Alignment:
| Q |
254 |
tcatccccgtgagcttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
|||||||||||||||||||||||||| ||| |||||||||| |||||| |
|
|
| T |
39587542 |
tcatccccgtgagcttagctcagttggtagagatattgcattttatat |
39587589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 252 - 303
Target Start/End: Complemental strand, 41616443 - 41616392
Alignment:
| Q |
252 |
tttcatccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||| || |||||||| ||||||||||| ||||||||||| |
|
|
| T |
41616443 |
tttcatccccgtgagcataactcagttggtagggatattgtatattatatgc |
41616392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 43186850 - 43186897
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||| |||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43186850 |
atccgcgtgagtttagctcagttggtagggatattgcatattatatgc |
43186897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 260 - 303
Target Start/End: Complemental strand, 43980382 - 43980339
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
43980382 |
ccgtgagcttagttcagttgttagggatattgcatattatatgc |
43980339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 256 - 302
Target Start/End: Original strand, 2590146 - 2590192
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
2590146 |
atccccgtgagcttagctcaattagtagggatattgcatattatatg |
2590192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 261 - 303
Target Start/End: Original strand, 10573103 - 10573145
Alignment:
| Q |
261 |
cgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10573103 |
cgtgagtttagctcagttggtagggatattgcatattatatgc |
10573145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 259 - 301
Target Start/End: Complemental strand, 18452355 - 18452313
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
18452355 |
cccgtgagcttagctcagttgttaggaatattgcatattatat |
18452313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 261 - 303
Target Start/End: Complemental strand, 26192784 - 26192742
Alignment:
| Q |
261 |
cgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
26192784 |
cgtgagcttagttcagttggtagggatattgcatattatatgc |
26192742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 261 - 303
Target Start/End: Original strand, 38344051 - 38344093
Alignment:
| Q |
261 |
cgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
38344051 |
cgtgagcttaactcagttggtagggatattgcatattatatgc |
38344093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 257 - 299
Target Start/End: Original strand, 38402249 - 38402291
Alignment:
| Q |
257 |
tccccgtgagcttagctcagttgatagggatattgcatattat |
299 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
38402249 |
tccccgtgagcttaactcagttggtagggatattgcatattat |
38402291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 261 - 303
Target Start/End: Original strand, 41458297 - 41458339
Alignment:
| Q |
261 |
cgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
41458297 |
cgtgagcttaactcagttggtagggatattgcatattatatgc |
41458339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 253 - 303
Target Start/End: Complemental strand, 44260265 - 44260215
Alignment:
| Q |
253 |
ttcatccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||| || | ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
44260265 |
ttcatccctgtaaacttagctcagttgatagagatattgcatattatatgc |
44260215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 256 - 301
Target Start/End: Complemental strand, 2168520 - 2168475
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||| |||||| |
|
|
| T |
2168520 |
atccccgtgagcttagctcagttggtagggatattacattttatat |
2168475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 258 - 303
Target Start/End: Complemental strand, 4615747 - 4615702
Alignment:
| Q |
258 |
ccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||| |||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
4615747 |
ccccgtgagtttagttcagttggtagggatattgcatattatatgc |
4615702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 262 - 303
Target Start/End: Complemental strand, 8862193 - 8862152
Alignment:
| Q |
262 |
gtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
8862193 |
gtgagcttagctaagttggtagggatattgcatattatatgc |
8862152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 256 - 301
Target Start/End: Original strand, 29729115 - 29729160
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
||||||||||| |||| ||||||| ||||||||||||||||||||| |
|
|
| T |
29729115 |
atccccgtgagtttagttcagttggtagggatattgcatattatat |
29729160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 258 - 303
Target Start/End: Complemental strand, 43856453 - 43856408
Alignment:
| Q |
258 |
ccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||| |||||||| |
|
|
| T |
43856453 |
ccccgtgagcttaactcagttggtagggatattgcattttatatgc |
43856408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 262 - 302
Target Start/End: Complemental strand, 197131 - 197091
Alignment:
| Q |
262 |
gtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
197131 |
gtgagcttagctcagttggtagggatattgcatataatatg |
197091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 262 - 302
Target Start/End: Complemental strand, 311968 - 311928
Alignment:
| Q |
262 |
gtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
311968 |
gtgagcttagctcagttggtagggatattgcatataatatg |
311928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 259 - 303
Target Start/End: Original strand, 5570894 - 5570938
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||| |||||||| |
|
|
| T |
5570894 |
cccgtgagcttagctcagttggttgggatattgcatgttatatgc |
5570938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 303
Target Start/End: Original strand, 7194266 - 7194306
Alignment:
| Q |
263 |
tgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
7194266 |
tgagcttagttcagttggtagggatattgcatattatatgc |
7194306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 259 - 303
Target Start/End: Original strand, 7765643 - 7765687
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||| || ||||||| |||||||||||| |
|
|
| T |
7765643 |
cccgtgagcttagctcagttggtatggatattacatattatatgc |
7765687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 303
Target Start/End: Complemental strand, 22274677 - 22274637
Alignment:
| Q |
263 |
tgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
22274677 |
tgagtttagctcagttggtagggatattgcatattatatgc |
22274637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 261 - 301
Target Start/End: Original strand, 28460203 - 28460243
Alignment:
| Q |
261 |
cgtgagcttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
28460203 |
cgtgagcttaactcagttggtagggatattgcatattatat |
28460243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 259 - 303
Target Start/End: Original strand, 32258007 - 32258051
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
32258007 |
cccgtgagattagctcagttggtagggatattgcatattctatgc |
32258051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 251 - 303
Target Start/End: Complemental strand, 42877415 - 42877363
Alignment:
| Q |
251 |
gtttcatccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||| || ||||||||||||| ||| ||||||| ||||||||||| |
|
|
| T |
42877415 |
gtttcatccccgcgaacttagctcagttggtagagatattgtatattatatgc |
42877363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 252 - 295
Target Start/End: Original strand, 481004 - 481047
Alignment:
| Q |
252 |
tttcatccccgtgagcttagctcagttgatagggatattgcata |
295 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
481004 |
tttcgtccccgtgagcttagctcagttggtagggacattgcata |
481047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 260 - 303
Target Start/End: Complemental strand, 3823944 - 3823901
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
3823944 |
ccgtgagcttagctcaattgatagggatattatatattatatgc |
3823901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 262 - 301
Target Start/End: Complemental strand, 3949148 - 3949109
Alignment:
| Q |
262 |
gtgagcttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
3949148 |
gtgagcttaactcagttggtagggatattgcatattatat |
3949109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 264 - 303
Target Start/End: Complemental strand, 7764004 - 7763965
Alignment:
| Q |
264 |
gagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
7764004 |
gagcttagctcagttggtagagatattgcatattatatgc |
7763965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 259 - 294
Target Start/End: Original strand, 8839447 - 8839482
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcat |
294 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
8839447 |
cccgtgagcatagctcagttgatagggatattgcat |
8839482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 8953942 - 8953895
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||| |||||||||| | |||||| ||||||||||||||||||||||| |
|
|
| T |
8953942 |
atcctcgtgagcttaacacagttggtagggatattgcatattatatgc |
8953895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 10030409 - 10030456
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||| ||||| |||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
10030409 |
atccctgtgagtttagctcagttggtagagatattgcatattatatgc |
10030456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 259 - 302
Target Start/End: Complemental strand, 11297063 - 11297020
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||| ||||||| |
|
|
| T |
11297063 |
cccgtgagcttagttcagttggtagggatattgcattttatatg |
11297020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 291
Target Start/End: Complemental strand, 11962617 - 11962582
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattg |
291 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |
|
|
| T |
11962617 |
atccccgtgagcttagctcagttgatagagatattg |
11962582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 260 - 303
Target Start/End: Original strand, 22487876 - 22487919
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||| |||||||| |
|
|
| T |
22487876 |
ccgtgagtttagctcagttggtagggatattgcattttatatgc |
22487919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 26395361 - 26395408
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||| |||| ||||||||||| ||||||||||| |||||||| |
|
|
| T |
26395361 |
atccccgtgaacttatctcagttgataaggatattgcattttatatgc |
26395408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 26734069 - 26734116
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
26734069 |
atccccgtaagcttagctcagttggtagatatattgcatattatatgc |
26734116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 29260616 - 29260663
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||| |||||||||| ||||| || ||||||||||||||||||||||| |
|
|
| T |
29260616 |
atccacgtgagcttaactcagctggtagggatattgcatattatatgc |
29260663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 268 - 303
Target Start/End: Complemental strand, 30925426 - 30925391
Alignment:
| Q |
268 |
ttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
30925426 |
ttagctcagttgatagggatattgaatattatatgc |
30925391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 291
Target Start/End: Complemental strand, 33604245 - 33604210
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattg |
291 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
33604245 |
atccccgtgagcttagctcagttggtagggatattg |
33604210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 259 - 302
Target Start/End: Original strand, 33838324 - 33838367
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||| |||||||| |
|
|
| T |
33838324 |
cccgtgagtttagctcagttggtagggatattgcaaattatatg |
33838367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 37090686 - 37090639
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| ||| |||||||| ||||||||||| ||||||||||| |
|
|
| T |
37090686 |
atccccgtgagtttaactcagttggtagggatattgtatattatatgc |
37090639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 264 - 303
Target Start/End: Complemental strand, 37524272 - 37524233
Alignment:
| Q |
264 |
gagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
37524272 |
gagcttagctcagttggtagagatattgcatattatatgc |
37524233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 260 - 303
Target Start/End: Complemental strand, 43053954 - 43053911
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| |||||||| |||||||||| |||||||||||| |
|
|
| T |
43053954 |
ccgtgagcttaactcagttggtagggatatttcatattatatgc |
43053911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 256 - 302
Target Start/End: Original strand, 7453349 - 7453395
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
||||||||||| ||||||||| || |||||||||||||| ||||||| |
|
|
| T |
7453349 |
atccccgtgagtttagctcagctggtagggatattgcattttatatg |
7453395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 259 - 301
Target Start/End: Complemental strand, 12273747 - 12273705
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
12273747 |
cccgtgagcttagctcagttagtaggaatattgcatattatat |
12273705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 257 - 295
Target Start/End: Original strand, 12770366 - 12770404
Alignment:
| Q |
257 |
tccccgtgagcttagctcagttgatagggatattgcata |
295 |
Q |
| |
|
||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
12770366 |
tccccatgagcttagctcagttgatagggacattgcata |
12770404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 256 - 302
Target Start/End: Original strand, 14245143 - 14245189
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
||||||||||| |||| | ||||| |||||||||||||||||||||| |
|
|
| T |
14245143 |
atccccgtgagtttaggtaagttggtagggatattgcatattatatg |
14245189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #138
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 261 - 295
Target Start/End: Complemental strand, 22437858 - 22437824
Alignment:
| Q |
261 |
cgtgagcttagctcagttgatagggatattgcata |
295 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |
|
|
| T |
22437858 |
cgtgagcttagctcagttggtagggatattgcata |
22437824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #139
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 261 - 303
Target Start/End: Complemental strand, 45190627 - 45190585
Alignment:
| Q |
261 |
cgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||| ||| |||||||| ||||||||||||||||||| |
|
|
| T |
45190627 |
cgtgagcttaactcggttgatagagatattgcatattatatgc |
45190585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #140
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 262 - 303
Target Start/End: Complemental strand, 1632507 - 1632466
Alignment:
| Q |
262 |
gtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||| |||| ||||| |||||||||||| |
|
|
| T |
1632507 |
gtgagcttagctcagttggtaggaatattacatattatatgc |
1632466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #141
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 266 - 303
Target Start/End: Complemental strand, 7109353 - 7109316
Alignment:
| Q |
266 |
gcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
7109353 |
gcttagctcagttggtagagatattgcatattatatgc |
7109316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #142
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 262 - 303
Target Start/End: Original strand, 8969098 - 8969139
Alignment:
| Q |
262 |
gtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||| ||||| |||| |||||||||||||||||| |
|
|
| T |
8969098 |
gtgagcttagctaagttggtaggaatattgcatattatatgc |
8969139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #143
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 258 - 303
Target Start/End: Complemental strand, 10594287 - 10594242
Alignment:
| Q |
258 |
ccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||| | ||||| |||||||||||||| |||||||| |
|
|
| T |
10594287 |
ccccgtgagcttagtttagttggtagggatattgcattttatatgc |
10594242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #144
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 261 - 302
Target Start/End: Complemental strand, 11289491 - 11289450
Alignment:
| Q |
261 |
cgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||| ||||||| |
|
|
| T |
11289491 |
cgtgagtttagctcatttgatagggatattgcattttatatg |
11289450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #145
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 262 - 303
Target Start/End: Original strand, 18942918 - 18942959
Alignment:
| Q |
262 |
gtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||| |||||||| |||||| ||||||| |
|
|
| T |
18942918 |
gtgagcttagctcagttggtagggataatgcataatatatgc |
18942959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #146
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 262 - 295
Target Start/End: Complemental strand, 20872525 - 20872492
Alignment:
| Q |
262 |
gtgagcttagctcagttgatagggatattgcata |
295 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
20872525 |
gtgagcttagctcagttgatagggacattgcata |
20872492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #147
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 262 - 303
Target Start/End: Complemental strand, 37535566 - 37535525
Alignment:
| Q |
262 |
gtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||| |||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
37535566 |
gtgagtttagctcaattggtagggatattgcatattatatgc |
37535525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #148
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 251 - 292
Target Start/End: Original strand, 39169494 - 39169535
Alignment:
| Q |
251 |
gtttcatccccgtgagcttagctcagttgatagggatattgc |
292 |
Q |
| |
|
||||||||||||||| ||||||| ||||| |||||||||||| |
|
|
| T |
39169494 |
gtttcatccccgtgaacttagcttagttggtagggatattgc |
39169535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #149
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 259 - 300
Target Start/End: Original strand, 42457133 - 42457174
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattata |
300 |
Q |
| |
|
|||||||| ||| |||||||| |||||||||||||||||||| |
|
|
| T |
42457133 |
cccgtgagtttatctcagttggtagggatattgcatattata |
42457174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #150
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 259 - 303
Target Start/End: Complemental strand, 8402406 - 8402362
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||| ||| |||||| |||||||| ||||||| |
|
|
| T |
8402406 |
cccgtgagcttagctcaattggtagggacattgcataatatatgc |
8402362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #151
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 9370162 - 9370212
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgat---agggatattgcatattatatgc |
303 |
Q |
| |
|
|||||| ||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
9370162 |
atccccatgagcttagctcagttgttggtagggatattgcatattatatgc |
9370212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #152
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 261 - 301
Target Start/End: Original strand, 11127905 - 11127945
Alignment:
| Q |
261 |
cgtgagcttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
||||| ||||||||||||| |||| |||||||||||||||| |
|
|
| T |
11127905 |
cgtgaacttagctcagttggtaggaatattgcatattatat |
11127945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #153
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 259 - 303
Target Start/End: Original strand, 11483120 - 11483164
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||| |||||||||| |||| |||||||||||||||||| |
|
|
| T |
11483120 |
cccgtgagcgtagctcagttagtaggaatattgcatattatatgc |
11483164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #154
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 259 - 303
Target Start/End: Complemental strand, 14181412 - 14181368
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||| |||||||||| ||| |||||||| ||||||| |
|
|
| T |
14181412 |
cccgtgagcttagatcagttgataaggacattgcataatatatgc |
14181368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #155
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 3 - 31
Target Start/End: Original strand, 22156500 - 22156528
Alignment:
| Q |
3 |
tttgacaactcaagagaacttttggtatg |
31 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
22156500 |
tttgacaactcaagagaacttttggtatg |
22156528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #156
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 259 - 295
Target Start/End: Original strand, 39974841 - 39974877
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcata |
295 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
39974841 |
cccgtgagcttagctcagttggtaggaatattgcata |
39974877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #157
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 259 - 303
Target Start/End: Complemental strand, 44673718 - 44673674
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||| |||||||| |
|
|
| T |
44673718 |
cccgtgagcttagctcagttggtagggatatcacattttatatgc |
44673674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 79; Significance: 6e-37; HSPs: 119)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 1 - 184
Target Start/End: Original strand, 14105160 - 14105338
Alignment:
| Q |
1 |
tatttgacaactcaagagaacttttggtatggtatgagtagaagtgagggaggggaactcaatttataggtgaagaaccaaagataagttacaaatccaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||| ||| ||||| ||||||||||| ||| ||| |||||||||||| || |||||||| |||||||||||||| |
|
|
| T |
14105160 |
tatttgacaactcaagagaacttttgg---ggt--gagtaaaagtgagggagaggagctctatttataggtgaggagccaaagatgagttacaaatccaa |
14105254 |
T |
 |
| Q |
101 |
tggctaggattagttgaccgttagaaaatcaatggcttgatctctcatcataaatgagcactaattgagaaagttgacaagaga |
184 |
Q |
| |
|
||||||||||||||||||| || |||||||||| | |||| |||| ||| ||||||||||| | || || |||||||| |||| |
|
|
| T |
14105255 |
tggctaggattagttgacctctacaaaatcaatgacatgatttctcctcagaaatgagcactcaatgggatagttgacatgaga |
14105338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 5521293 - 5521246
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5521293 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
5521246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 254 - 303
Target Start/End: Original strand, 20296413 - 20296462
Alignment:
| Q |
254 |
tcatccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
20296413 |
tcatccccgtgagcttagctcagttgataaggatattgcatattatatgc |
20296462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 254 - 303
Target Start/End: Original strand, 38400305 - 38400354
Alignment:
| Q |
254 |
tcatccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38400305 |
tcatccccgtgagcttagctcagttggtagggatattgcatattatatgc |
38400354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 255 - 303
Target Start/End: Original strand, 19684069 - 19684117
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19684069 |
catccccgtgagcttagctcagttggtagggatattgcatattatatgc |
19684117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 251 - 303
Target Start/End: Original strand, 28194624 - 28194676
Alignment:
| Q |
251 |
gtttcatccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28194624 |
gtttcatccccatgagcttagctcagttgctagggatattgcatattatatgc |
28194676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 3446727 - 3446774
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3446727 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
3446774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 4183173 - 4183220
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4183173 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
4183220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 8250374 - 8250327
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8250374 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
8250327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 18694782 - 18694829
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18694782 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
18694829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 19281605 - 19281652
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19281605 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
19281652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 22653717 - 22653670
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
22653717 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
22653670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 25857368 - 25857321
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25857368 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
25857321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 33229006 - 33228959
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33229006 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
33228959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 44948593 - 44948640
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44948593 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
44948640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 252 - 302
Target Start/End: Original strand, 1260178 - 1260228
Alignment:
| Q |
252 |
tttcatccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
1260178 |
tttcatccccgtgagcttagctcagttggtagggatattgcatgttatatg |
1260228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 254 - 303
Target Start/End: Original strand, 15764925 - 15764974
Alignment:
| Q |
254 |
tcatccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
15764925 |
tcatcctcgtgagcttagctcagttggtagggatattgcatattatatgc |
15764974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 254 - 303
Target Start/End: Original strand, 27297170 - 27297219
Alignment:
| Q |
254 |
tcatccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
27297170 |
tcatccccgtgagcttagctcagttggtagggatattgcatattgtatgc |
27297219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 258 - 303
Target Start/End: Original strand, 34613978 - 34614023
Alignment:
| Q |
258 |
ccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34613978 |
ccccgtgagcttagctcagttggtagggatattgcatattatatgc |
34614023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 62 - 134
Target Start/End: Complemental strand, 13059945 - 13059873
Alignment:
| Q |
62 |
atttataggtgaagaaccaaagataagttacaaatccaatggctaggattagttgaccgttagaaaatcaatg |
134 |
Q |
| |
|
|||||||||||| || ||||||||||||| |||| |||||||||||||||||||||| || |||||||||| |
|
|
| T |
13059945 |
atttataggtgaggagtcaaagataagttataaattcaatggctaggattagttgaccatttaaaaatcaatg |
13059873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 255 - 303
Target Start/End: Complemental strand, 18278491 - 18278443
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18278491 |
catccccgtgagtttagctcagttggtagggatattgcatattatatgc |
18278443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 251 - 303
Target Start/End: Complemental strand, 39408768 - 39408716
Alignment:
| Q |
251 |
gtttcatccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||| ||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
39408768 |
gttttatccccgtgagcttaactcagttggtagggatattgcatattatatgc |
39408716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 1844814 - 1844861
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1844814 |
atccccgtaagcttagctcagttggtagggatattgcatattatatgc |
1844861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 2289607 - 2289654
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
2289607 |
atccccgtgagcttagctcagttggtaggaatattgcatattatatgc |
2289654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 2643694 - 2643741
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2643694 |
atccccgtgagcatagctcagttggtagggatattgcatattatatgc |
2643741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 3438945 - 3438992
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3438945 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgc |
3438992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 4562825 - 4562778
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4562825 |
atccccgtgagtttagctcagttggtagggatattgcatattatatgc |
4562778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 6331559 - 6331606
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6331559 |
atccccgtgagcatagctcagttggtagggatattgcatattatatgc |
6331606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 11050830 - 11050783
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
11050830 |
atccccgtgagcttagctcagttggtagggatattacatattatatgc |
11050783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 15233410 - 15233457
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
15233410 |
atccccgtgagcttagctcaattggtagggatattgcatattatatgc |
15233457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 15485659 - 15485706
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
15485659 |
atccccgtgagcttagctcagttggtaaggatattgcatattatatgc |
15485706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 17034732 - 17034779
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
17034732 |
atccccgtgagcttagctcaattggtagggatattgcatattatatgc |
17034779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 17078454 - 17078501
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
17078454 |
atccccgtgagcttagctcagttggtagggatattgtatattatatgc |
17078501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 28195207 - 28195160
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28195207 |
atcctcgtgagcttagctcagttggtagggatattgcatattatatgc |
28195160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 30932519 - 30932472
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
30932519 |
atccccgtgagcttacctcagttggtagggatattgcatattatatgc |
30932472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 33233295 - 33233248
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
33233295 |
atccccgtgagcttatctcagttggtagggatattgcatattatatgc |
33233248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 33549127 - 33549080
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
33549127 |
atccccgtgagcttagctcagttgatagagatattgtatattatatgc |
33549080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 40535522 - 40535475
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
40535522 |
atccccgtgagcttagctcagttggtacggatattgcatattatatgc |
40535475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 260 - 303
Target Start/End: Original strand, 41509517 - 41509560
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41509517 |
ccgtgagcttagctcagttggtagggatattgcatattatatgc |
41509560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 44857307 - 44857260
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44857307 |
atcctcgtgagcttagctcagttggtagggatattgcatattatatgc |
44857260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 255 - 301
Target Start/End: Original strand, 5062293 - 5062339
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
5062293 |
catccccgtgagcttaactcagttggtagggatattgcatattatat |
5062339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 253 - 303
Target Start/End: Complemental strand, 7379676 - 7379626
Alignment:
| Q |
253 |
ttcatccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||| |||||||| || |||||||||||||||||||| |
|
|
| T |
7379676 |
ttcatccccgtgagcttaactcagttggtaaggatattgcatattatatgc |
7379626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 261 - 303
Target Start/End: Original strand, 36182644 - 36182686
Alignment:
| Q |
261 |
cgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36182644 |
cgtgagcttagctcagttggtagggatattgcatattatatgc |
36182686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 257 - 303
Target Start/End: Original strand, 41566760 - 41566806
Alignment:
| Q |
257 |
tccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
41566760 |
tccccgtgagcttagctcagttggtaggaatattgcatattatatgc |
41566806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 262 - 303
Target Start/End: Complemental strand, 6636034 - 6635993
Alignment:
| Q |
262 |
gtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6636034 |
gtgagcttagctcagttggtagggatattgcatattatatgc |
6635993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 255 - 303
Target Start/End: Complemental strand, 3287130 - 3287082
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3287130 |
catccctgtgagcttagctcagttggaagggatattgcatattatatgc |
3287082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 256 - 300
Target Start/End: Original strand, 5474903 - 5474947
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattata |
300 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5474903 |
atccccgtgagcttagctcagttggcagggatattgcatattata |
5474947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 259 - 303
Target Start/End: Complemental strand, 9330571 - 9330527
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
9330571 |
cccgtgagcttaactcagttgatagagatattgcatattatatgc |
9330527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 259 - 303
Target Start/End: Complemental strand, 27913539 - 27913495
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
27913539 |
cccgtgagcttagctcaattggtagggatattgcatattatatgc |
27913495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 466679 - 466632
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||| |||||||||||| |
|
|
| T |
466679 |
atccccgtgagcatagctcagttggtagggatattacatattatatgc |
466632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 1071467 - 1071514
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||| ||||||||||| |
|
|
| T |
1071467 |
atccccgtgagcttagctcagttggtatggatattgtatattatatgc |
1071514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 259 - 302
Target Start/End: Complemental strand, 2806571 - 2806528
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
2806571 |
cccgtgagcttagctcagttggtagggatattgtatattatatg |
2806528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 260 - 303
Target Start/End: Original strand, 17487705 - 17487748
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
17487705 |
ccgtgaacttagctcagttggtagggatattgcatattatatgc |
17487748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 18803208 - 18803255
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||| ||| |||| |||||||||||||||||| |
|
|
| T |
18803208 |
atccccgtgagcttagctcacttggtaggaatattgcatattatatgc |
18803255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 259 - 302
Target Start/End: Original strand, 19612715 - 19612758
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
19612715 |
cccgtgagcttagttcagttggtagggatattgcatattatatg |
19612758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 27497601 - 27497554
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||||| |||||||| |
|
|
| T |
27497601 |
atccccgtgagcatagctcagttggtagggatattgcatgttatatgc |
27497554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 263 - 302
Target Start/End: Complemental strand, 30392898 - 30392859
Alignment:
| Q |
263 |
tgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30392898 |
tgagcttagctcagttggtagggatattgcatattatatg |
30392859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 260 - 303
Target Start/End: Complemental strand, 32609256 - 32609213
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
32609256 |
ccgtgagcttaactcagttggtagggatattgcatattatatgc |
32609213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 33041936 - 33041889
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| ||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
33041936 |
atccccgtgagtttaactcagttggtagggatattgcatattatatgc |
33041889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 35798099 - 35798052
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||| |||||||| ||| ||||||||||||||||||| |
|
|
| T |
35798099 |
atccccgtgagcttaactcagttgttagagatattgcatattatatgc |
35798052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 38525626 - 38525579
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||||| |||||||| |
|
|
| T |
38525626 |
atccccgtgagcttagctcagttggtaaggatattgcattttatatgc |
38525579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 44822420 - 44822467
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||| |||||||| |
|
|
| T |
44822420 |
atccccgtgagcttagctcagttggtagggatatcgcattttatatgc |
44822467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 257 - 303
Target Start/End: Original strand, 23405194 - 23405240
Alignment:
| Q |
257 |
tccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||||| |||||| |||||||| ||||||| |
|
|
| T |
23405194 |
tccccgtgagcttagctcagttggtagggacattgcataatatatgc |
23405240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 256 - 302
Target Start/End: Original strand, 33669733 - 33669779
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
33669733 |
atccccgtgagcttaactcagttagtagggatattgcatattatatg |
33669779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 260 - 302
Target Start/End: Complemental strand, 40363140 - 40363098
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
40363140 |
ccgtgagcttaactcagttggtagggatattgcatattatatg |
40363098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 7 - 178
Target Start/End: Complemental strand, 44957060 - 44956894
Alignment:
| Q |
7 |
acaactcaagagaacttttggtatggtatgagtagaagtgagggaggggaactcaatttataggtgaagaaccaaagataagttacaaatccaatggcta |
106 |
Q |
| |
|
||||||||||||||||||||| ||| ||||| |||||||| | | || || |||||||||||| ||| ||||||| | || | |||| | |||| |
|
|
| T |
44957060 |
acaactcaagagaacttttgg---ggt--gagtacaagtgaggaatgagagttctatttataggtgatgaatcaaagatgaattttagatccgacagcta |
44956966 |
T |
 |
| Q |
107 |
ggattagttgaccgttagaaaatcaatggcttgatctctcatcataaatgagcactaattgagaaagttgac |
178 |
Q |
| |
|
||| | |||||||||||||||| ||| | |||| || | ||||||||||||| ||||||||||||||||| |
|
|
| T |
44956965 |
agatcatttgaccgttagaaaattaattgtttgacatcacctcataaatgagcaataattgagaaagttgac |
44956894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 262 - 303
Target Start/End: Original strand, 5612957 - 5612998
Alignment:
| Q |
262 |
gtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5612957 |
gtgagcttagctcagttggcagggatattgcatattatatgc |
5612998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 256 - 301
Target Start/End: Original strand, 35367408 - 35367453
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
35367408 |
atccccatgagcttagctcagttgataatgatattgcatattatat |
35367453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 258 - 303
Target Start/End: Original strand, 44658329 - 44658374
Alignment:
| Q |
258 |
ccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
44658329 |
ccccgtgagcttagctcagttagtaggaatattgcatattatatgc |
44658374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 255 - 303
Target Start/End: Complemental strand, 22718135 - 22718087
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||| || ||||||||||| |
|
|
| T |
22718135 |
catccccgtgagcttaactcagttggtagggatactgtatattatatgc |
22718087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 259 - 303
Target Start/End: Original strand, 27449183 - 27449227
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||| |||||||| |
|
|
| T |
27449183 |
cccgtgagcatagctcagttggtagggatattgcattttatatgc |
27449227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 259 - 303
Target Start/End: Complemental strand, 30390439 - 30390395
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30390439 |
cccgtgaatttagctcagttggtagggatattgcatattatatgc |
30390395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 303
Target Start/End: Original strand, 31223624 - 31223664
Alignment:
| Q |
263 |
tgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
31223624 |
tgagcttagttcagttggtagggatattgcatattatatgc |
31223664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 262 - 302
Target Start/End: Original strand, 32168931 - 32168971
Alignment:
| Q |
262 |
gtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
32168931 |
gtgagcttaactcagttggtagggatattgcatattatatg |
32168971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 268 - 303
Target Start/End: Original strand, 1500970 - 1501005
Alignment:
| Q |
268 |
ttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1500970 |
ttagctcagttggtagggatattgcatattatatgc |
1501005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 260 - 303
Target Start/End: Complemental strand, 7281757 - 7281714
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||| | |||||||||| ||||||||||||||||||||||| |
|
|
| T |
7281757 |
ccgtgagttaagctcagttggtagggatattgcatattatatgc |
7281714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 259 - 302
Target Start/End: Complemental strand, 8742894 - 8742851
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
||||||||||||||||||||| ||| |||||| ||||||||||| |
|
|
| T |
8742894 |
cccgtgagcttagctcagttggtagagatattacatattatatg |
8742851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 10195729 - 10195682
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||| |||||| ||||||| |
|
|
| T |
10195729 |
atcctcgtgagcttagctcagttgatatggataatgcataatatatgc |
10195682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 28153215 - 28153168
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||| ||||||||| |||||||| |||||||||||||| |||||||| |
|
|
| T |
28153215 |
atcccagtgagcttaactcagttggtagggatattgcatgttatatgc |
28153168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 252 - 303
Target Start/End: Original strand, 33262435 - 33262486
Alignment:
| Q |
252 |
tttcatccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||| ||||||||| || ||||||||| |||| |||||||| |
|
|
| T |
33262435 |
tttcatccccgtgagtttagctcagctggtagggatatcgcattttatatgc |
33262486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 36005439 - 36005486
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||| || |||| ||| ||||||||||||||||||||||| |
|
|
| T |
36005439 |
atccccgtgagcgtaactcaattggtagggatattgcatattatatgc |
36005486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 38179318 - 38179271
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||| ||||| |||||||||||| |||||||||||||| |||||||| |
|
|
| T |
38179318 |
atccctgtgagtttagctcagttggtagggatattgcattttatatgc |
38179271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 38557296 - 38557249
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||| |||| |||||||| |
|
|
| T |
38557296 |
atccccgtgagcttaactcagttggtagggatatggcattttatatgc |
38557249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 43895910 - 43895957
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||| |||||||| |
|
|
| T |
43895910 |
atccccgtgagcttagctcagttggtagggatatcacattttatatgc |
43895957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 260 - 303
Target Start/End: Original strand, 43936702 - 43936745
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||| |||||||| |
|
|
| T |
43936702 |
ccgtgagcttagctcagttggtagggatatcgcattttatatgc |
43936745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 259 - 301
Target Start/End: Original strand, 3301811 - 3301853
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||| |||||| |
|
|
| T |
3301811 |
cccgtgagcttagctcatttggtagggatattgcattttatat |
3301853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 256 - 302
Target Start/End: Complemental strand, 7907616 - 7907570
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||||||||||| | | ||| |||||||||||||||||||||| |
|
|
| T |
7907616 |
atccccgtgagcttagtttaattggtagggatattgcatattatatg |
7907570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 272 - 302
Target Start/End: Complemental strand, 18559270 - 18559240
Alignment:
| Q |
272 |
ctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
18559270 |
ctcagttgatagggatattgcatattatatg |
18559240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 257 - 295
Target Start/End: Original strand, 19958097 - 19958135
Alignment:
| Q |
257 |
tccccgtgagcttagctcagttgatagggatattgcata |
295 |
Q |
| |
|
||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
19958097 |
tccccgtgagcttagctcagttggtagggacattgcata |
19958135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 257 - 295
Target Start/End: Original strand, 20919608 - 20919646
Alignment:
| Q |
257 |
tccccgtgagcttagctcagttgatagggatattgcata |
295 |
Q |
| |
|
||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
20919608 |
tccccgtgagcttagctcagttggtagggacattgcata |
20919646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 261 - 303
Target Start/End: Original strand, 27244656 - 27244698
Alignment:
| Q |
261 |
cgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||| ||||||| |
|
|
| T |
27244656 |
cgtgagcttagctcagttgatagggacaatgcataatatatgc |
27244698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 302
Target Start/End: Complemental strand, 29772347 - 29772305
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
||||||||||| | |||||| |||||||||||||||||||||| |
|
|
| T |
29772347 |
ccgtgagcttaacacagttggtagggatattgcatattatatg |
29772305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 261 - 303
Target Start/End: Complemental strand, 34434462 - 34434420
Alignment:
| Q |
261 |
cgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||| || ||||||||||||||||| ||||||||||| |
|
|
| T |
34434462 |
cgtgagcttaacttagttgatagggatattgtatattatatgc |
34434420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 261 - 303
Target Start/End: Original strand, 40864401 - 40864443
Alignment:
| Q |
261 |
cgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||| |||||||| |
|
|
| T |
40864401 |
cgtgagcttagctcagttggtaggaatattgcattttatatgc |
40864443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 302
Target Start/End: Original strand, 41286132 - 41286174
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||||| | ||||||| |||||||||||||||||||||| |
|
|
| T |
41286132 |
ccgtgagcttggttcagttggtagggatattgcatattatatg |
41286174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 257 - 295
Target Start/End: Original strand, 43214354 - 43214392
Alignment:
| Q |
257 |
tccccgtgagcttagctcagttgatagggatattgcata |
295 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
43214354 |
tccccgtgagcttaactcagttggtagggatattgcata |
43214392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 262 - 303
Target Start/End: Original strand, 8702576 - 8702617
Alignment:
| Q |
262 |
gtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
8702576 |
gtgagtttagctcatctgatagggatattgcatattatatgc |
8702617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 262 - 303
Target Start/End: Original strand, 8732232 - 8732273
Alignment:
| Q |
262 |
gtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
8732232 |
gtgagtttagctcatctgatagggatattgcatattatatgc |
8732273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 301
Target Start/End: Original strand, 8763379 - 8763424
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||| |||||| |
|
|
| T |
8763379 |
atccccgtgagcttagctcaattcgtagggatattgcattttatat |
8763424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 268 - 301
Target Start/End: Complemental strand, 11288294 - 11288261
Alignment:
| Q |
268 |
ttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
11288294 |
ttagctcagttgatagtgatattgcatattatat |
11288261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 260 - 301
Target Start/End: Original strand, 27016278 - 27016319
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
|||||||||||| ||||||| || |||||||||||||||||| |
|
|
| T |
27016278 |
ccgtgagcttagttcagttggtatggatattgcatattatat |
27016319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 261 - 302
Target Start/End: Original strand, 28202296 - 28202337
Alignment:
| Q |
261 |
cgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||| |||||| |
|
|
| T |
28202296 |
cgtgagcttagctcagttgatagggacaatgcataatatatg |
28202337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 262 - 303
Target Start/End: Complemental strand, 29942193 - 29942152
Alignment:
| Q |
262 |
gtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
29942193 |
gtgagcttaactcagttagtagggatattgcatattatatgc |
29942152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 262 - 303
Target Start/End: Original strand, 37063523 - 37063564
Alignment:
| Q |
262 |
gtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||| |||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
37063523 |
gtgatcttacctcagttggtagggatattgcatattatatgc |
37063564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 262 - 303
Target Start/End: Complemental strand, 37352560 - 37352519
Alignment:
| Q |
262 |
gtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||| ||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
37352560 |
gtgagtttaactcagttggtagggatattgcatattatatgc |
37352519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 262 - 303
Target Start/End: Original strand, 42039211 - 42039252
Alignment:
| Q |
262 |
gtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||| ||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
42039211 |
gtgagtttagctcagttgatatggatagtgcatattatatgc |
42039252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 301
Target Start/End: Original strand, 44021071 - 44021116
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
||||||||||||||| |||||||| |||| ||||||||| |||||| |
|
|
| T |
44021071 |
atccccgtgagcttaactcagttggtaggaatattgcatgttatat |
44021116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 303
Target Start/End: Complemental strand, 5168639 - 5168599
Alignment:
| Q |
263 |
tgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||| ||||||| |
|
|
| T |
5168639 |
tgagcttaactcagttgatagggataatgcataatatatgc |
5168599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 255 - 303
Target Start/End: Complemental strand, 5398181 - 5398133
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||| |||| ||||||||||||| |||||||||| ||| |||||||| |
|
|
| T |
5398181 |
catccctgtgaacttagctcagttggtagggatattacattttatatgc |
5398133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 303
Target Start/End: Original strand, 14835285 - 14835325
Alignment:
| Q |
263 |
tgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||| |||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
14835285 |
tgagtttagctcagttgatagtgatattgtatattatatgc |
14835325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 303
Target Start/End: Complemental strand, 16385108 - 16385068
Alignment:
| Q |
263 |
tgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||| || ||||||||||| |||||||| |
|
|
| T |
16385108 |
tgagcttagctcagttggtatggatattgcattttatatgc |
16385068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 255 - 303
Target Start/End: Original strand, 20239336 - 20239384
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||| |||||||||| |||| |||||||||||| |||||| ||||||| |
|
|
| T |
20239336 |
catccgcgtgagcttaactcaattgatagggataatgcataatatatgc |
20239384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 303
Target Start/End: Original strand, 22589903 - 22589943
Alignment:
| Q |
263 |
tgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||| || ||||| ||||||||||||||||||||||| |
|
|
| T |
22589903 |
tgagcttatcttagttggtagggatattgcatattatatgc |
22589943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 262 - 302
Target Start/End: Complemental strand, 23919544 - 23919504
Alignment:
| Q |
262 |
gtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||| |||||| |
|
|
| T |
23919544 |
gtgagcttagctcagttggtagggacattgcataatatatg |
23919504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 255 - 303
Target Start/End: Complemental strand, 24581538 - 24581490
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||| |||||| |||||||| |||||||||||||| ||||||| |
|
|
| T |
24581538 |
catccccgtaagcttaactcagttggcagggatattgcataatatatgc |
24581490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 262 - 302
Target Start/End: Complemental strand, 33222221 - 33222181
Alignment:
| Q |
262 |
gtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||| |||| |||||||| |||||||||||||||||||||| |
|
|
| T |
33222221 |
gtgaacttaactcagttggtagggatattgcatattatatg |
33222181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #117
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 3 - 31
Target Start/End: Complemental strand, 36735874 - 36735846
Alignment:
| Q |
3 |
tttgacaactcaagagaacttttggtatg |
31 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
36735874 |
tttgacaactcaagagaacttttggtatg |
36735846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #118
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 255 - 303
Target Start/End: Complemental strand, 40688713 - 40688665
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||| ||||| ||||||||||||| ||| |||||||||| |||||||| |
|
|
| T |
40688713 |
catcctcgtgatcttagctcagttggtagagatattgcattttatatgc |
40688665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #119
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 259 - 303
Target Start/End: Complemental strand, 42633585 - 42633541
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||| |||| | |||||||||| |||||||||||||||||| |
|
|
| T |
42633585 |
cccgtgagtttagtttagttgataggaatattgcatattatatgc |
42633541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 74; Significance: 6e-34; HSPs: 150)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 1 - 184
Target Start/End: Original strand, 16983538 - 16983718
Alignment:
| Q |
1 |
tatttgacaactcaagagaacttttggtatggtatgagtagaagtgagggaggggaactcaatttataggtgaagaaccaaagataagttacaaatccaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||| | | || |||||||||||||| ||| ||| | ||||||||||| | |||||||| | |||||||||||| |
|
|
| T |
16983538 |
tatttgacaactcaagagaacttttgg----gga-gaatagaagtgagggagaggagctctacttataggtgaaaagccaaagatgaattacaaatccaa |
16983632 |
T |
 |
| Q |
101 |
tggctaggattagttgaccgttagaaaatcaatggcttgatctctcatcataaatgagcacta--attgagaaagttgacaagaga |
184 |
Q |
| |
|
|| ||| |||||||||||||||| |||||||||||||||||||| | |||||||||| |||| |||||||||||| ||| |||| |
|
|
| T |
16983633 |
tgactatgattagttgaccgttaaaaaatcaatggcttgatctcgcctcataaatgaatactaatattgagaaagtttacatgaga |
16983718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 1 - 184
Target Start/End: Complemental strand, 48431821 - 48431645
Alignment:
| Q |
1 |
tatttgacaactcaagagaacttttggtatggtatgagtagaagtgagggaggggaactcaatttataggtgaagaaccaaagataagttacaaatccaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||| ||| ||||||||||| ||||| || ||| ||||||||||||||| ||||| || |||||||||||||| |
|
|
| T |
48431821 |
tatttgacaactcaagagaacttttgg---ggt--gagtagaagtgtgggagatgagctctatttataggtgaagagccaaatatgagttacaaatccaa |
48431727 |
T |
 |
| Q |
101 |
tggctaggattagttgaccgttagaaaatcaatggcttgatctctcatcataaatgagcactaattgagaaagttgacaagaga |
184 |
Q |
| |
|
|||||||||||||||||| | | |||||||| | |||| ||| ||||||||||||||| | ||||| |||||||| |||| |
|
|
| T |
48431726 |
tggctaggattagttgac--atctacaatcaatgacatgatttcttctcataaatgagcactcaatgagatagttgacatgaga |
48431645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 62 - 184
Target Start/End: Original strand, 4662797 - 4662919
Alignment:
| Q |
62 |
atttataggtgaagaaccaaagataagttacaaatccaatggctaggattagttgaccgttagaaaatcaatggcttgatctctcatcataaatgagcac |
161 |
Q |
| |
|
|||||||||| | || ||| ||||||||||||||||||||| ||||||||||||||||| || |||||||||| | | || |||| |||||||||||||| |
|
|
| T |
4662797 |
atttataggtaaggagccagagataagttacaaatccaatgcctaggattagttgaccgctacaaaatcaatgacataatttctcctcataaatgagcac |
4662896 |
T |
 |
| Q |
162 |
taattgagaaagttgacaagaga |
184 |
Q |
| |
|
| | ||||| |||||||| |||| |
|
|
| T |
4662897 |
tcaatgagatagttgacatgaga |
4662919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 35 - 179
Target Start/End: Complemental strand, 48435376 - 48435233
Alignment:
| Q |
35 |
tgagtagaagtgagggaggggaactcaatttataggtgaagaaccaaagataagttacaaatccaatggctaggattagttgaccgttagaaaatcaatg |
134 |
Q |
| |
|
||||||||||||| |||| | ||| |||||||||| |||| |||||||| |||||||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
48435376 |
tgagtagaagtgaaggagatgggctctatttataggtaaagagccaaagatgagttacaaatccaatggctaggattagttgacatcta-caaatcaatg |
48435278 |
T |
 |
| Q |
135 |
gcttgatctctcatcataaatgagcactaattgagaaagttgaca |
179 |
Q |
| |
|
| |||| |||| ||||||||||||||| | ||||| |||||||| |
|
|
| T |
48435277 |
acatgatttctcctcataaatgagcactcaatgagatagttgaca |
48435233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 255 - 303
Target Start/End: Original strand, 19999863 - 19999911
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19999863 |
catccccgtgagcttagctcagttggtagggatattgcatattatatgc |
19999911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 255 - 303
Target Start/End: Complemental strand, 28550393 - 28550345
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28550393 |
catccccgtgagcttagctcagttggtagggatattgcatattatatgc |
28550345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 255 - 303
Target Start/End: Complemental strand, 31327575 - 31327527
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31327575 |
catccccgtgagcttagctcagttggtagggatattgcatattatatgc |
31327527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 255 - 303
Target Start/End: Complemental strand, 31327792 - 31327744
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31327792 |
catccccgtgagcttagctcagttggtagggatattgcatattatatgc |
31327744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 255 - 303
Target Start/End: Original strand, 40548299 - 40548347
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40548299 |
catccccgtgagcttagctcagttggtagggatattgcatattatatgc |
40548347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 255 - 303
Target Start/End: Complemental strand, 52410315 - 52410267
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
52410315 |
catccccgtgagcttagctcagttggtagggatattgcatattatatgc |
52410267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 255 - 303
Target Start/End: Original strand, 52945891 - 52945939
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
52945891 |
catccccgtgagcttagctcagttggtagggatattgcatattatatgc |
52945939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 882386 - 882433
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
882386 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
882433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 2522923 - 2522970
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2522923 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
2522970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 7269952 - 7269999
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7269952 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
7269999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 7920317 - 7920364
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7920317 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
7920364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 19550503 - 19550550
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19550503 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
19550550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 22502004 - 22501957
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
22502004 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
22501957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 37800684 - 37800637
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37800684 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
37800637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 39966147 - 39966100
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39966147 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
39966100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 40192153 - 40192200
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40192153 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
40192200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 40933904 - 40933857
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40933904 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
40933857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 44652055 - 44652008
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44652055 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
44652008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 45701341 - 45701388
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45701341 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
45701388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 48251569 - 48251616
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48251569 |
atccctgtgagcttagctcagttgatagggatattgcatattatatgc |
48251616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 50496887 - 50496840
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
50496887 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
50496840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 252 - 303
Target Start/End: Complemental strand, 52974130 - 52974079
Alignment:
| Q |
252 |
tttcatccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
52974130 |
tttcatccccgtgagcttaactcagttggtagggatattgcatattatatgc |
52974079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 53347363 - 53347316
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
53347363 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
53347316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 261 - 303
Target Start/End: Complemental strand, 49750474 - 49750432
Alignment:
| Q |
261 |
cgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49750474 |
cgtgagcttagctcagttgatagggatattgcatattatatgc |
49750432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 256 - 302
Target Start/End: Original strand, 53163591 - 53163637
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
53163591 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
53163637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 258 - 303
Target Start/End: Complemental strand, 6920034 - 6919989
Alignment:
| Q |
258 |
ccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6920034 |
ccccgtgagcttagctcagttggtagggatattgcatattatatgc |
6919989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 255 - 296
Target Start/End: Original strand, 10349401 - 10349442
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatat |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10349401 |
catccccgtgagcttagctcagttgatagggatattgcatat |
10349442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 250 - 303
Target Start/End: Complemental strand, 30555306 - 30555253
Alignment:
| Q |
250 |
agtttcatccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||| |||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
30555306 |
agttttatccccgtgagcttagctcagttggtagggatattgcatattaaatgc |
30555253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 256 - 301
Target Start/End: Original strand, 31316631 - 31316676
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
31316631 |
atccccgtgagcttagctcagttgatagggatattgtatattatat |
31316676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 254 - 303
Target Start/End: Complemental strand, 50536907 - 50536858
Alignment:
| Q |
254 |
tcatccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
50536907 |
tcatccccgtgagcttagctcagttggtagagatattgcatattatatgc |
50536858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 259 - 303
Target Start/End: Original strand, 4139000 - 4139044
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4139000 |
cccgtgagcttagctcagttggtagggatattgcatattatatgc |
4139044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 259 - 303
Target Start/End: Complemental strand, 9176656 - 9176612
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9176656 |
cccgtgagcttagctcagttggtagggatattgcatattatatgc |
9176612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 255 - 303
Target Start/End: Original strand, 31586943 - 31586991
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31586943 |
catccccatgagcttagctcagttggtagggatattgcatattatatgc |
31586991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 255 - 303
Target Start/End: Complemental strand, 41936481 - 41936433
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41936481 |
catccccgtaagcttagctcagttggtagggatattgcatattatatgc |
41936433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 259 - 303
Target Start/End: Original strand, 47098732 - 47098776
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
47098732 |
cccgtgagcttagctcagttggtagggatattgcatattatatgc |
47098776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 2368933 - 2368980
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2368933 |
atcctcgtgagcttagctcagttgttagggatattgcatattatatgc |
2368980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 2390427 - 2390380
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
2390427 |
atccccgtaagcgtagctcagttgatagggatattgcatattatatgc |
2390380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 3748675 - 3748628
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
3748675 |
atccccgtgagcttagctcagttggtagggatattgtatattatatgc |
3748628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 10176976 - 10176929
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10176976 |
atccccgtgaggttagctcagttggtagggatattgcatattatatgc |
10176929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 10482926 - 10482879
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10482926 |
atccccgtgaacttagctcagttggtagggatattgcatattatatgc |
10482879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 15975149 - 15975196
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
15975149 |
atccctgtgagcttagctcagttggtagggatattgcatattatatgc |
15975196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 17218485 - 17218532
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
17218485 |
atccccatgagcttagctcagttggtagggatattgcatattatatgc |
17218532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 18194335 - 18194382
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18194335 |
atccccgtgagtttagctcagttggtagggatattgcatattatatgc |
18194382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 19996525 - 19996478
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19996525 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgc |
19996478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 25939003 - 25938956
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25939003 |
atccccgtgagtttagctcagttggtagggatattgcatattatatgc |
25938956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 28689745 - 28689698
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28689745 |
atccccgtgaacttagctcagttggtagggatattgcatattatatgc |
28689698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 30779640 - 30779593
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30779640 |
atcctcgtgagcttagctcagttggtagggatattgcatattatatgc |
30779593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 31529031 - 31528984
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
31529031 |
atccccgtgagcttagctcagttggtagggatattgaatattatatgc |
31528984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 32256627 - 32256580
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
32256627 |
atccccgtgagcttagctcagttggtagggatattgcatgttatatgc |
32256580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 34102684 - 34102637
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
34102684 |
atccccgtgagcttagttcagttggtagggatattgcatattatatgc |
34102637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 34898840 - 34898793
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
34898840 |
atccccgtgagcttagttcagttggtagggatattgcatattatatgc |
34898793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 46796002 - 46795955
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
46796002 |
atccccgtgagcttagctcagttggtagggatattgcattttatatgc |
46795955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 48739817 - 48739770
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
48739817 |
atccccgtgagcttagctcagttggtagggatattgcattttatatgc |
48739770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 261 - 303
Target Start/End: Original strand, 8125641 - 8125683
Alignment:
| Q |
261 |
cgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8125641 |
cgtgagcttagctcagttggtagggatattgcatattatatgc |
8125683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 256 - 302
Target Start/End: Original strand, 11820001 - 11820047
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
11820001 |
atccccgtgagcttagctcagttggtagggatattgcatgttatatg |
11820047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 261 - 303
Target Start/End: Original strand, 46879999 - 46880041
Alignment:
| Q |
261 |
cgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
46879999 |
cgtgagcttagctcagttgatagggatattgcattttatatgc |
46880041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 262 - 303
Target Start/End: Complemental strand, 5636866 - 5636825
Alignment:
| Q |
262 |
gtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5636866 |
gtgagcttagctcagttggtagggatattgcatattatatgc |
5636825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 261 - 302
Target Start/End: Complemental strand, 17602744 - 17602703
Alignment:
| Q |
261 |
cgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
17602744 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
17602703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 254 - 303
Target Start/End: Complemental strand, 33225423 - 33225374
Alignment:
| Q |
254 |
tcatccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |||| |||||||| |
|
|
| T |
33225423 |
tcatccccgtgagcttagctcagttggtagggatatcgcattttatatgc |
33225374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 258 - 303
Target Start/End: Original strand, 50234123 - 50234168
Alignment:
| Q |
258 |
ccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
50234123 |
ccccgtgagcttacctcagttggtagggatattgcatattatatgc |
50234168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 259 - 303
Target Start/End: Original strand, 26942753 - 26942797
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26942753 |
cccgtaagcttagctcagttggtagggatattgcatattatatgc |
26942797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 259 - 303
Target Start/End: Original strand, 32828441 - 32828485
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
32828441 |
cccgtgagcttagctcggttggtagggatattgcatattatatgc |
32828485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 263 - 303
Target Start/End: Complemental strand, 36625237 - 36625197
Alignment:
| Q |
263 |
tgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36625237 |
tgagcttagctcagttggtagggatattgcatattatatgc |
36625197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 259 - 303
Target Start/End: Original strand, 39719935 - 39719979
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39719935 |
cccgtgagtttagctcagttggtagggatattgcatattatatgc |
39719979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 247 - 303
Target Start/End: Original strand, 44364010 - 44364065
Alignment:
| Q |
247 |
aatagtttcatccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||| ||||||||||| ||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
44364010 |
aatagttt-atccccgtgagtttaactcagttggtagggatattgcatattatatgc |
44364065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 253 - 301
Target Start/End: Complemental strand, 52046461 - 52046413
Alignment:
| Q |
253 |
ttcatccccgtgagcttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
52046461 |
ttcattcccgtgagcttagctcagttggtagggatattgcattttatat |
52046413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 255 - 303
Target Start/End: Complemental strand, 54769904 - 54769856
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||| |||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
54769904 |
catctccgtgagcttagcttagttggtagggatattgcatattatatgc |
54769856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 6488121 - 6488168
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||| ||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
6488121 |
atccccatgagcttagctcaattggtagggatattgcatattatatgc |
6488168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 8964849 - 8964802
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||||| |||||| |
|
|
| T |
8964849 |
atccccgtgagtttagctcagttggtagggatattgcatatcatatgc |
8964802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 17608392 - 17608345
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||| || ||||| ||||||||||||||||||||||| |
|
|
| T |
17608392 |
atccccgtgagcttaacttagttggtagggatattgcatattatatgc |
17608345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 22472387 - 22472340
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||| |||||||| ||| ||||||||||||||||||| |
|
|
| T |
22472387 |
atccccgtgagcttaactcagttggtagagatattgcatattatatgc |
22472340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 32144581 - 32144628
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||| ||||| ||||| ||||||||||||||||| |
|
|
| T |
32144581 |
atccccgtgagcttagcttagttggtaggggtattgcatattatatgc |
32144628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 33706800 - 33706753
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| |||||||||||| |
|
|
| T |
33706800 |
atccccgtgagcttagctcaattggtagggatattacatattatatgc |
33706753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 34847540 - 34847587
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
34847540 |
atccccgtgagcttaattcagttggtagggatattgcatattatatgc |
34847587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 37488533 - 37488486
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||| |||||||| |
|
|
| T |
37488533 |
atccccgtgagcttagctcagttggtagggatatcgcattttatatgc |
37488486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 40963784 - 40963737
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||||||||| |||||||| |
|
|
| T |
40963784 |
atccccgtgagcttaactcagttgataaggatattgcattttatatgc |
40963737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 45871014 - 45871061
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
45871014 |
atccccgtgagtttagctcagttggtagggatattgtatattatatgc |
45871061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 260 - 303
Target Start/End: Complemental strand, 46730842 - 46730799
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
46730842 |
ccgtgagcttagctcagttgataggcatatagcatattatatgc |
46730799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 259 - 302
Target Start/End: Original strand, 48546173 - 48546216
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
48546173 |
cccgtgagcttagctcagttggtagtgatattgcatattatatg |
48546216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 49408772 - 49408819
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||| || ||||||||| ||||||||||||| |
|
|
| T |
49408772 |
atccccgtgagcttagctcagctggtagggatatcgcatattatatgc |
49408819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 49447135 - 49447182
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
49447135 |
atccccgtgagtatagctcagttggtagggatattgcatattatatgc |
49447182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 51467173 - 51467220
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
51467173 |
atccccgtgaacttagctcagttgatagggatatcgcattttatatgc |
51467220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 259 - 302
Target Start/End: Complemental strand, 52670223 - 52670180
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
52670223 |
cccgtgagcttagttcagttggtagggatattgcatattatatg |
52670180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 53752773 - 53752726
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||| ||||||||||||| |
|
|
| T |
53752773 |
atccccgtgagcttaactcagttggtagggatatggcatattatatgc |
53752726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 265 - 303
Target Start/End: Complemental strand, 4640544 - 4640506
Alignment:
| Q |
265 |
agcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4640544 |
agcttagctcagttggtagggatattgcatattatatgc |
4640506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 261 - 303
Target Start/End: Complemental strand, 11250659 - 11250617
Alignment:
| Q |
261 |
cgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11250659 |
cgtgaacttagctcagttggtagggatattgcatattatatgc |
11250617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 256 - 302
Target Start/End: Complemental strand, 13638318 - 13638272
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||| ||||||||||| |
|
|
| T |
13638318 |
atccccgtgagcttagttcagttggtagggatattacatattatatg |
13638272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 256 - 302
Target Start/End: Complemental strand, 19591652 - 19591606
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||| |||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
19591652 |
atccccttgagcttagctcagttgataagtatattgcatattatatg |
19591606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 255 - 301
Target Start/End: Complemental strand, 44685242 - 44685196
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
||||||||||||||||||| ||||| ||| ||||||||||||||||| |
|
|
| T |
44685242 |
catccccgtgagcttagcttagttggtagagatattgcatattatat |
44685196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 256 - 302
Target Start/End: Complemental strand, 45551882 - 45551836
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||| ||||||| |
|
|
| T |
45551882 |
atccccgtgagcttagctcagttggtagggatatcgcattttatatg |
45551836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 254 - 303
Target Start/End: Complemental strand, 8762155 - 8762106
Alignment:
| Q |
254 |
tcatccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||| || ||||| |||||||||| |||||||||||| |
|
|
| T |
8762155 |
tcatccccgtgagcttaacttagttggtagggatattacatattatatgc |
8762106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 259 - 296
Target Start/End: Original strand, 34757529 - 34757566
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatat |
296 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34757529 |
cccgtgagcttagctcagttggtagggatattgcatat |
34757566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 262 - 303
Target Start/End: Complemental strand, 36834772 - 36834731
Alignment:
| Q |
262 |
gtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
36834772 |
gtgagcttagctcagctgatagggatattgtatattatatgc |
36834731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 258 - 303
Target Start/End: Complemental strand, 52309181 - 52309136
Alignment:
| Q |
258 |
ccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||| ||||||| |
|
|
| T |
52309181 |
ccccgtgagcttaactcagttggtagggatattgcatactatatgc |
52309136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 262 - 303
Target Start/End: Original strand, 52984013 - 52984054
Alignment:
| Q |
262 |
gtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
52984013 |
gtgagcttagctcagttggtagggatattgcatattgtatgc |
52984054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 262 - 303
Target Start/End: Original strand, 53577958 - 53577999
Alignment:
| Q |
262 |
gtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
53577958 |
gtgagcttagctcagttggtagggatgttgcatattatatgc |
53577999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 262 - 303
Target Start/End: Complemental strand, 54021401 - 54021360
Alignment:
| Q |
262 |
gtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
54021401 |
gtgagcttagctcagttggtatggatattgcatattatatgc |
54021360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 259 - 303
Target Start/End: Original strand, 3894544 - 3894588
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||| ||||||| || |||||||||||||||||||| |
|
|
| T |
3894544 |
cccgtgagcttagttcagttggtatggatattgcatattatatgc |
3894588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 259 - 303
Target Start/End: Original strand, 4541898 - 4541942
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||| ||||||||||| |
|
|
| T |
4541898 |
cccgtgagcttagttcagttggtagggatattgtatattatatgc |
4541942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 259 - 303
Target Start/End: Original strand, 4860161 - 4860205
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||| |||||||| |
|
|
| T |
4860161 |
cccgtgagcttagctcagttggtacggatattgcattttatatgc |
4860205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 259 - 303
Target Start/End: Original strand, 4880169 - 4880213
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||| |||||||| |
|
|
| T |
4880169 |
cccgtgagcttagctcagttggtacggatattgcattttatatgc |
4880213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 259 - 303
Target Start/End: Complemental strand, 5326106 - 5326062
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
| T |
5326106 |
cccgtgagcttagctcagttggtagcgatattgcatattacatgc |
5326062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 258 - 302
Target Start/End: Original strand, 19866473 - 19866516
Alignment:
| Q |
258 |
ccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
19866473 |
ccccgtgagcttagctcagt-gatagggatattgcattttatatg |
19866516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 303
Target Start/End: Original strand, 20489819 - 20489859
Alignment:
| Q |
263 |
tgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
20489819 |
tgagcttagctcagttggtagggttattgcatattatatgc |
20489859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 259 - 303
Target Start/End: Original strand, 24430146 - 24430190
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||| ||||||||||| |
|
|
| T |
24430146 |
cccgtgagcttagctcagttggtagagatattgtatattatatgc |
24430190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 259 - 303
Target Start/End: Complemental strand, 29373519 - 29373475
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||| |||||||| || |||||||||||||||||||| |
|
|
| T |
29373519 |
cccgtgagcttaactcagttggtaaggatattgcatattatatgc |
29373475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 256 - 300
Target Start/End: Original strand, 39300381 - 39300425
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattata |
300 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||| ||||| |
|
|
| T |
39300381 |
atccccgtgagcttagctcagttggtagggatattacattttata |
39300425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 260 - 300
Target Start/End: Original strand, 43645076 - 43645116
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattata |
300 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
43645076 |
ccgtgagcttagctcagttgacagggatatttcatattata |
43645116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 11436501 - 11436548
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||| ||||| |||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
11436501 |
atcctcgtgaacttaactcagttggtagggatattgcatattatatgc |
11436548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 259 - 302
Target Start/End: Complemental strand, 12894600 - 12894557
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||| ||||||| |
|
|
| T |
12894600 |
cccgtgagcttaactcagttggtagggatattgcattttatatg |
12894557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 13018786 - 13018833
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||| ||| ||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
13018786 |
atccccttgaacttagttcagttgatagagatattgcatattatatgc |
13018833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 255 - 302
Target Start/End: Complemental strand, 25279133 - 25279086
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
||||| ||||||||||||| ||||| ||||||||||| |||||||||| |
|
|
| T |
25279133 |
catcctcgtgagcttagcttagttggtagggatattgtatattatatg |
25279086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 259 - 302
Target Start/End: Original strand, 25488885 - 25488928
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||| |
|
|
| T |
25488885 |
cccgtgagcttaactcagttgttagggatattacatattatatg |
25488928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 28193795 - 28193842
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||| |||||||| |||||||| |||||||||||||| |||||||| |
|
|
| T |
28193795 |
atccccttgagcttaactcagttggtagggatattgcattttatatgc |
28193842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 263 - 302
Target Start/End: Complemental strand, 29559740 - 29559701
Alignment:
| Q |
263 |
tgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
29559740 |
tgagcttaactcagttggtagggatattgcatattatatg |
29559701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 259 - 302
Target Start/End: Complemental strand, 34579520 - 34579477
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| || ||||||| |
|
|
| T |
34579520 |
cccgtgagcttaactcagttgatagggatattgaattttatatg |
34579477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 37921065 - 37921018
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||| |||||| ||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
37921065 |
atcctcgtgagtttagctcagttgatagggataatgcataatatatgc |
37921018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 40723733 - 40723686
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||| ||||||| |||||||| |||||||||||||| |||||||| |
|
|
| T |
40723733 |
atccccgagagcttaactcagttggtagggatattgcatgttatatgc |
40723686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 268 - 303
Target Start/End: Complemental strand, 42108243 - 42108208
Alignment:
| Q |
268 |
ttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42108243 |
ttagctcagttggtagggatattgcatattatatgc |
42108208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 261 - 300
Target Start/End: Complemental strand, 46045488 - 46045449
Alignment:
| Q |
261 |
cgtgagcttagctcagttgatagggatattgcatattata |
300 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
46045488 |
cgtgagcttaactcagttgataaggatattgcatattata |
46045449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 47099102 - 47099055
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||||||||| | ||| |||||| ||||||| |
|
|
| T |
47099102 |
atccccgtgagcttagctcagttgataagaataatgcataatatatgc |
47099055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 53432810 - 53432763
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||| ||||| ||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
53432810 |
atccctgtgagtttaactcagttggtagggatattgcatattatatgc |
53432763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 256 - 302
Target Start/End: Complemental strand, 1743870 - 1743824
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
||||||||||||||| |||| ||| |||||||||||||| ||||||| |
|
|
| T |
1743870 |
atccccgtgagcttaactcaattggtagggatattgcattttatatg |
1743824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 257 - 295
Target Start/End: Original strand, 11995129 - 11995167
Alignment:
| Q |
257 |
tccccgtgagcttagctcagttgatagggatattgcata |
295 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
11995129 |
tccccgtgagcttagttcagttgatagggacattgcata |
11995167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 261 - 303
Target Start/End: Original strand, 34740289 - 34740331
Alignment:
| Q |
261 |
cgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||| ||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
34740289 |
cgtgagtttagcccagttggtagggatattgcatattatatgc |
34740331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 257 - 303
Target Start/End: Original strand, 36763427 - 36763473
Alignment:
| Q |
257 |
tccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||| ||||||||| |||||| |||||||| ||||||| |
|
|
| T |
36763427 |
tccccgtgagcttggctcagttggtagggacattgcataatatatgc |
36763473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 302
Target Start/End: Original strand, 45198724 - 45198766
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
45198724 |
ccgttagcttagttcagttggtagggatattgcatattatatg |
45198766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 257 - 303
Target Start/End: Original strand, 52575461 - 52575507
Alignment:
| Q |
257 |
tccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||||| || | ||||||||| |||||||| |
|
|
| T |
52575461 |
tccccgtgagcttagctcagttggtacgaatattgcattttatatgc |
52575507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 262 - 303
Target Start/End: Original strand, 552174 - 552215
Alignment:
| Q |
262 |
gtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| ||||||| |
|
|
| T |
552174 |
gtgagcttaactcagttggtagggatattgcataatatatgc |
552215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 262 - 303
Target Start/End: Complemental strand, 4200652 - 4200611
Alignment:
| Q |
262 |
gtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||| |||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
4200652 |
gtgaacttaactcagttggtagggatattgcatattatatgc |
4200611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 301
Target Start/End: Complemental strand, 16895303 - 16895258
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
||||||| ||||||| |||||||| |||| |||||||||||||||| |
|
|
| T |
16895303 |
atccccgagagcttaactcagttggtaggaatattgcatattatat |
16895258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 262 - 303
Target Start/End: Complemental strand, 38562236 - 38562195
Alignment:
| Q |
262 |
gtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||| |||| |||||| |||||||||||||||||||| |
|
|
| T |
38562236 |
gtgagcttacctcaattgataaggatattgcatattatatgc |
38562195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 266 - 303
Target Start/End: Original strand, 44106609 - 44106646
Alignment:
| Q |
266 |
gcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
44106609 |
gcttaactcagttgctagggatattgcatattatatgc |
44106646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 301
Target Start/End: Complemental strand, 45513068 - 45513023
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
|||||||| |||||||||||||| || |||||||||||||||||| |
|
|
| T |
45513068 |
atccccgtaagcttagctcagttagtatggatattgcatattatat |
45513023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 260 - 301
Target Start/End: Complemental strand, 50675811 - 50675770
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
||||||| ||| |||||||| ||||||||||||||||||||| |
|
|
| T |
50675811 |
ccgtgagtttatctcagttggtagggatattgcatattatat |
50675770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 262 - 303
Target Start/End: Original strand, 51772892 - 51772933
Alignment:
| Q |
262 |
gtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||| || ||||| ||||||||||||||||||||||| |
|
|
| T |
51772892 |
gtgagcttaacttagttggtagggatattgcatattatatgc |
51772933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 7448465 - 7448417
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgca-tattatatgc |
303 |
Q |
| |
|
|||||||||||| |||||||||||||||||| | |||| |||||||||| |
|
|
| T |
7448465 |
atccccgtgagcatagctcagttgatagggacaatgcattattatatgc |
7448417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 7456607 - 7456559
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgca-tattatatgc |
303 |
Q |
| |
|
|||||||||||| |||||||||||||||||| | |||| |||||||||| |
|
|
| T |
7456607 |
atccccgtgagcatagctcagttgatagggacaatgcattattatatgc |
7456559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 299
Target Start/End: Complemental strand, 16906903 - 16906867
Alignment:
| Q |
263 |
tgagcttagctcagttgatagggatattgcatattat |
299 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
16906903 |
tgagcttggctcagttgctagggatattgcatattat |
16906867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 259 - 303
Target Start/End: Original strand, 17728992 - 17729035
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||| ||||| || |||||||||||||||||| |
|
|
| T |
17728992 |
cccgtgagcttagctcaattgattgg-atattgcatattatatgc |
17729035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 259 - 303
Target Start/End: Original strand, 19030221 - 19030264
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||| ||||| || |||||||||||||||||| |
|
|
| T |
19030221 |
cccgtgagcttagctcaattgattgg-atattgcatattatatgc |
19030264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #146
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 251 - 303
Target Start/End: Original strand, 25833815 - 25833867
Alignment:
| Q |
251 |
gtttcatccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||| ||| |||| ||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
25833815 |
gtttgatctccgttagcttagctcagttggtaaagatattgcatattatatgc |
25833867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #147
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 303
Target Start/End: Complemental strand, 28396848 - 28396808
Alignment:
| Q |
263 |
tgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||| |||||||| |||||||||||||| |||||||| |
|
|
| T |
28396848 |
tgagcttaactcagttggtagggatattgcatgttatatgc |
28396808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #148
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 255 - 303
Target Start/End: Original strand, 31922352 - 31922400
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||| |||||||| || | |||||||||||||||||| |
|
|
| T |
31922352 |
catccccgtgagcttgtctcagttggtaagaatattgcatattatatgc |
31922400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #149
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 259 - 303
Target Start/End: Complemental strand, 33607009 - 33606965
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||| ||||||||| ||| |||||||||||||| |||||||| |
|
|
| T |
33607009 |
cccgtgaacttagctcaattggtagggatattgcattttatatgc |
33606965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #150
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 303
Target Start/End: Original strand, 37112814 - 37112854
Alignment:
| Q |
263 |
tgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||| || ||||||||||| |||||||| |
|
|
| T |
37112814 |
tgagcttagctcagttggtaaggatattgcattttatatgc |
37112854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0018 (Bit Score: 69; Significance: 6e-31; HSPs: 1)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 3 - 159
Target Start/End: Complemental strand, 171231 - 171080
Alignment:
| Q |
3 |
tttgacaactcaagagaacttttggtatggtatgagtagaagtgagggaggggaactcaatttataggtgaagaaccaaagataagttacaaatccaatg |
102 |
Q |
| |
|
||||||||||||||| ||||||||| ||| ||||||||||| |||| ||| ||| ||||||||||||||| ||||| || |||||||||||||||| |
|
|
| T |
171231 |
tttgacaactcaagataacttttgggatg-----agtagaagtgaaggagaggagctctatttataggtgaagagccaaaaatgagttacaaatccaatg |
171137 |
T |
 |
| Q |
103 |
gctaggattagttgaccgttagaaaatcaatggcttgatctctcatcataaatgagc |
159 |
Q |
| |
|
|||||||||| |||||| || |||||||||| | |||| |||| |||||||||||| |
|
|
| T |
171136 |
gctaggattaattgacctctacaaaatcaatgacatgatttctcctcataaatgagc |
171080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 49; Significance: 5e-19; HSPs: 121)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 62 - 162
Target Start/End: Original strand, 15591225 - 15591325
Alignment:
| Q |
62 |
atttataggtgaagaaccaaagataagttacaaatccaatggctaggattagttgaccgttagaaaatcaatggcttgatctctcatcataaatgagcac |
161 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||| ||||||||||||| || || || ||||||| | ||||||| | |||||||||||||| |
|
|
| T |
15591225 |
atttataggtgaggagacaaagataagttacaaatccaatgattaggattagttgatcgctacaatatcaatgacatgatctcgcctcataaatgagcac |
15591324 |
T |
 |
| Q |
162 |
t |
162 |
Q |
| |
|
| |
|
|
| T |
15591325 |
t |
15591325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 254 - 303
Target Start/End: Original strand, 32505683 - 32505732
Alignment:
| Q |
254 |
tcatccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32505683 |
tcatccccgtgagcttagctcagttggtagggatattgcatattatatgc |
32505732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 255 - 303
Target Start/End: Complemental strand, 6518850 - 6518802
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6518850 |
catccccgtgagcttagctcagttggtagggatattgcatattatatgc |
6518802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 255 - 303
Target Start/End: Original strand, 12463752 - 12463800
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
12463752 |
catccccgtgagcttagctcagttggtagggatattgcatattatatgc |
12463800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 255 - 303
Target Start/End: Original strand, 15241392 - 15241440
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
15241392 |
catccccgtgagcttagctcagttgataggaatattgcatattatatgc |
15241440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 255 - 303
Target Start/End: Complemental strand, 41179877 - 41179829
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41179877 |
catccccgtgagcttagctcagttggtagggatattgcatattatatgc |
41179829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 1743124 - 1743171
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1743124 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
1743171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 4417758 - 4417711
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4417758 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
4417711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 9835030 - 9835077
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9835030 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
9835077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 11897245 - 11897292
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11897245 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
11897292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 16603395 - 16603442
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16603395 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
16603442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 17545245 - 17545198
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
17545245 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
17545198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 21918049 - 21918096
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
21918049 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
21918096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 27765254 - 27765301
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27765254 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
27765301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 42320314 - 42320361
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42320314 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
42320361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 256 - 302
Target Start/End: Original strand, 12891554 - 12891600
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
12891554 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
12891600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 258 - 303
Target Start/End: Complemental strand, 11188753 - 11188708
Alignment:
| Q |
258 |
ccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
11188753 |
ccccgtgagcttagctcagttgataggaatattgcatattatatgc |
11188708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 254 - 303
Target Start/End: Original strand, 24132932 - 24132981
Alignment:
| Q |
254 |
tcatccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
24132932 |
tcatccccgtgagcttagctcagttgatagagatattgcgtattatatgc |
24132981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 258 - 303
Target Start/End: Complemental strand, 25472654 - 25472609
Alignment:
| Q |
258 |
ccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25472654 |
ccccgtgagcttagctcagttggtagggatattgcatattatatgc |
25472609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 254 - 303
Target Start/End: Complemental strand, 36888470 - 36888421
Alignment:
| Q |
254 |
tcatccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
36888470 |
tcatccccgtgagcttagttcagttggtagggatattgcatattatatgc |
36888421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 258 - 302
Target Start/End: Complemental strand, 4745947 - 4745903
Alignment:
| Q |
258 |
ccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4745947 |
ccccgtgagcttagctcagttggtagggatattgcatattatatg |
4745903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 255 - 303
Target Start/End: Original strand, 5900288 - 5900336
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
5900288 |
catccccgtgagcttaactcagttggtagggatattgcatattatatgc |
5900336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 251 - 303
Target Start/End: Complemental strand, 13622024 - 13621972
Alignment:
| Q |
251 |
gtttcatccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
13622024 |
gttttatccccgtgagcttagctcagttggtagggatatcgcatattatatgc |
13621972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 259 - 303
Target Start/End: Complemental strand, 35113032 - 35112988
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35113032 |
cccgtgagcttagttcagttgatagggatattgcatattatatgc |
35112988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 259 - 303
Target Start/End: Original strand, 35515512 - 35515556
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35515512 |
cccgtgagcttagctcagttggtagggatattgcatattatatgc |
35515556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 2328589 - 2328636
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
2328589 |
atccccgtgagcttagcttagttggtagggatattgcatattatatgc |
2328636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 2848210 - 2848257
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
2848210 |
atccccgtgagcttagctcagttggtagggatattgtatattatatgc |
2848257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 5966826 - 5966873
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5966826 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgc |
5966873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 6558798 - 6558845
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
6558798 |
atccccgtgagcttagctcaattggtagggatattgcatattatatgc |
6558845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 8241047 - 8241094
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8241047 |
atccccatgagcttagctcagttggtagggatattgcatattatatgc |
8241094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 260 - 303
Target Start/End: Original strand, 8968750 - 8968793
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8968750 |
ccgtgagcttagctcagttggtagggatattgcatattatatgc |
8968793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 9125660 - 9125707
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
9125660 |
atccccgtgagcttagctcagttggtagcgatattgcatattatatgc |
9125707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 255 - 302
Target Start/End: Complemental strand, 11146603 - 11146556
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
11146603 |
catccccgtgagcttagctcagttgataaggatattgcatgttatatg |
11146556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 12767961 - 12768008
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
12767961 |
atccccgtgagcttagttcagttggtagggatattgcatattatatgc |
12768008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 18815345 - 18815392
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
18815345 |
atccccgtgagcttagctcagttggtaaggatattgcatattatatgc |
18815392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 21749450 - 21749403
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
21749450 |
atccccgtgagcttagctcagttggtagggatactgcatattatatgc |
21749403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 25648158 - 25648111
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
25648158 |
atccccgtgagcttagctcagttggtagggatattgcatattacatgc |
25648111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 29713449 - 29713402
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
29713449 |
atccccgtgagcttagctcagttggtagggatattgcctattatatgc |
29713402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 260 - 303
Target Start/End: Original strand, 36124400 - 36124443
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
36124400 |
ccgtgagcttagctcagttgataggaatattgcatattatatgc |
36124443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 39919166 - 39919119
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
39919166 |
atccccgtgagcttagcttagttggtagggatattgcatattatatgc |
39919119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 40091474 - 40091521
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
40091474 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgc |
40091521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 42525397 - 42525444
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42525397 |
atccccgtgagtttagctcagttggtagggatattgcatattatatgc |
42525444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 256 - 298
Target Start/End: Complemental strand, 18993534 - 18993492
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatatta |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
18993534 |
atccccgtgagcttagctcagttgatagggatattacatatta |
18993492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 256 - 302
Target Start/End: Original strand, 32706319 - 32706365
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
32706319 |
atccccgtgagcttagctcagttggtagggatattacatattatatg |
32706365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 256 - 302
Target Start/End: Complemental strand, 39886285 - 39886239
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
39886285 |
atccccgtgagcatagctcagttggtagggatattgcatattatatg |
39886239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 252 - 301
Target Start/End: Complemental strand, 22569321 - 22569272
Alignment:
| Q |
252 |
tttcatccccgtgagcttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
||||||||| |||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
22569321 |
tttcatccctgtgagcttagctcagttggtaggcatattgcatattatat |
22569272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 254 - 303
Target Start/End: Original strand, 32423560 - 32423609
Alignment:
| Q |
254 |
tcatccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||| ||||||||||| |
|
|
| T |
32423560 |
tcatccccgtgagcttaactcagttgttagggatattgtatattatatgc |
32423609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 255 - 303
Target Start/End: Complemental strand, 1269241 - 1269193
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||| ||| ||| ||||||||||||||||||| |
|
|
| T |
1269241 |
catccccgtgagcttagctcaattggtagagatattgcatattatatgc |
1269193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 263 - 303
Target Start/End: Complemental strand, 16386807 - 16386767
Alignment:
| Q |
263 |
tgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16386807 |
tgagcttagctcagttggtagggatattgcatattatatgc |
16386767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 259 - 303
Target Start/End: Original strand, 17666006 - 17666050
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
17666006 |
cccgtgagcttagctcagttggtaggaatattgcatattatatgc |
17666050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 259 - 303
Target Start/End: Complemental strand, 23292487 - 23292443
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
23292487 |
cccgtgagcttagctcagttggtagggatattgcatgttatatgc |
23292443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 263 - 303
Target Start/End: Original strand, 41156332 - 41156372
Alignment:
| Q |
263 |
tgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41156332 |
tgagcttagctcggttgatagggatattgcatattatatgc |
41156372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 259 - 303
Target Start/End: Original strand, 43580878 - 43580922
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43580878 |
cccgtgaacttagctcagttggtagggatattgcatattatatgc |
43580922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 260 - 303
Target Start/End: Original strand, 546803 - 546846
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
546803 |
ccgtgagcttaactcagttggtagggatattgcatattatatgc |
546846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 831589 - 831636
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||| |||||||||||| |
|
|
| T |
831589 |
atccccgtgagcttagctctgttggtagggatatttcatattatatgc |
831636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 252 - 303
Target Start/End: Original strand, 3198320 - 3198371
Alignment:
| Q |
252 |
tttcatccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||| |||||||| ||||||| |
|
|
| T |
3198320 |
tttcgtccccgtgagcttagctcagttggtagggacattgcataatatatgc |
3198371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 8478966 - 8478919
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| |||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
8478966 |
atccccgtgagtttagttcagttggtagggatattgcatattatatgc |
8478919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 260 - 303
Target Start/End: Original strand, 10241726 - 10241769
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
10241726 |
ccgtgagcttaactcagttggtagggatattgcatattatatgc |
10241769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 11774532 - 11774485
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11774532 |
atccccgtgaccttagctcagtttgtagggatattgcatattatatgc |
11774485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 24033074 - 24033121
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||| |||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
24033074 |
atccccgcgagcttagctcagttggtagggatattgcattttatatgc |
24033121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 25729513 - 25729466
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||| |||||||| |
|
|
| T |
25729513 |
atccccgtgagcttagctcagttggtagggatatcgcattttatatgc |
25729466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 27798618 - 27798665
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||| |||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27798618 |
atccctgtgagcatagctcagttggtagggatattgcatattatatgc |
27798665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 33736087 - 33736040
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||| ||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
33736087 |
atccccgggagcttaactcagttggtagggatattgcatattatatgc |
33736040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 260 - 303
Target Start/End: Complemental strand, 40361648 - 40361605
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40361648 |
ccgtgagtttagctcagttggtagggatattgcatattatatgc |
40361605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 41477431 - 41477384
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||| |||||||| |
|
|
| T |
41477431 |
atccccgtgagcttagctcagttggtagggatatcgcattttatatgc |
41477384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 42916386 - 42916433
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| || |||||||| |
|
|
| T |
42916386 |
atccccgtgagcttagctcagttggtagggatattgtatgttatatgc |
42916433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 261 - 303
Target Start/End: Original strand, 2362971 - 2363013
Alignment:
| Q |
261 |
cgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
2362971 |
cgtgagcttaactcagttggtagggatattgcatattatatgc |
2363013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 261 - 303
Target Start/End: Original strand, 6414070 - 6414112
Alignment:
| Q |
261 |
cgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
6414070 |
cgtgagcttaactcagttggtagggatattgcatattatatgc |
6414112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 256 - 302
Target Start/End: Original strand, 26912830 - 26912876
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
||||||||||||||| |||| ||| |||||||||||||||||||||| |
|
|
| T |
26912830 |
atccccgtgagcttaactcaattggtagggatattgcatattatatg |
26912876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 255 - 303
Target Start/End: Original strand, 988710 - 988759
Alignment:
| Q |
255 |
catccccgtgagcttagctcagtt-gatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||| ||||||| | ||||||||||||||||||||||| |
|
|
| T |
988710 |
catccccgtgagcttaactcagtttggtagggatattgcatattatatgc |
988759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 254 - 303
Target Start/End: Complemental strand, 21962180 - 21962131
Alignment:
| Q |
254 |
tcatccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||| |||||||| |||||||||||| ||||||||| |
|
|
| T |
21962180 |
tcatccccgtgagcttaactcagttggcagggatattgcaaattatatgc |
21962131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 262 - 303
Target Start/End: Complemental strand, 25400434 - 25400393
Alignment:
| Q |
262 |
gtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25400434 |
gtgagcatagctcagttggtagggatattgcatattatatgc |
25400393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 259 - 303
Target Start/End: Complemental strand, 8750971 - 8750927
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||| | ||||| ||||||||||||||||||||||| |
|
|
| T |
8750971 |
cccgtgagcttagttaagttggtagggatattgcatattatatgc |
8750927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 259 - 303
Target Start/End: Complemental strand, 14641179 - 14641135
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||||||||||||||||| |
|
|
| T |
14641179 |
cccgtgagcttaactcaattggtagggatattgcatattatatgc |
14641135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 261 - 301
Target Start/End: Original strand, 16891348 - 16891388
Alignment:
| Q |
261 |
cgtgagcttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
16891348 |
cgtgagcttagctcagttggtagggatattgcattttatat |
16891388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 256 - 300
Target Start/End: Original strand, 16971619 - 16971663
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattata |
300 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||| |||||||| |
|
|
| T |
16971619 |
atccccgtgagcttagctcagttggtagagatattgtatattata |
16971663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 259 - 303
Target Start/End: Original strand, 19985500 - 19985544
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||| ||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
19985500 |
cccgtgaccttagctcagttggtagggatattgcataatatatgc |
19985544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 262 - 302
Target Start/End: Original strand, 29154846 - 29154886
Alignment:
| Q |
262 |
gtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
29154846 |
gtgagcttagctcagttggtagggatagtgcatattatatg |
29154886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 259 - 303
Target Start/End: Original strand, 38696691 - 38696735
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||| |||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
38696691 |
cccgtaagcttaactcagttgatagggatattacatattatatgc |
38696735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 259 - 303
Target Start/End: Original strand, 41930105 - 41930149
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
41930105 |
cccgtgaacttaactcagttgatagggatattgcattttatatgc |
41930149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 3515538 - 3515491
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||| |||||| ||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
3515538 |
atcctcgtgagtttagctcagttgacagggatattgcgtattatatgc |
3515491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 3712139 - 3712092
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||| ||||||||||||||| ||| |||||||||| |||||||| |
|
|
| T |
3712139 |
atccccgtaagcttagctcagttggtagagatattgcattttatatgc |
3712092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 6526047 - 6526094
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| |||||||||||| ||| ||||||| ||||||||||| |
|
|
| T |
6526047 |
atccccgtgagtttagctcagttggtagagatattggatattatatgc |
6526094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 260 - 303
Target Start/End: Complemental strand, 11786129 - 11786086
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||| |||||||| |
|
|
| T |
11786129 |
ccgtgagcttaactcagttggtagggatattgcattttatatgc |
11786086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 17064931 - 17064884
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||| |||||||||| |||| ||| ||||||||||||||||||||||| |
|
|
| T |
17064931 |
atcctcgtgagcttaactcaattggtagggatattgcatattatatgc |
17064884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 268 - 303
Target Start/End: Original strand, 28308243 - 28308278
Alignment:
| Q |
268 |
ttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28308243 |
ttagctcagttggtagggatattgcatattatatgc |
28308278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 263 - 302
Target Start/End: Complemental strand, 34860206 - 34860167
Alignment:
| Q |
263 |
tgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
34860206 |
tgagcttagctcaattgatagggatattgtatattatatg |
34860167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 260 - 303
Target Start/End: Original strand, 35241397 - 35241440
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||| ||||||| ||| ||||||||||||||||||| |
|
|
| T |
35241397 |
ccgtgagcttagttcagttggtagagatattgcatattatatgc |
35241440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 260 - 303
Target Start/End: Original strand, 39165018 - 39165061
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||| |||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
39165018 |
ccgtgagtttagttcagttggtagggatattgcatattatatgc |
39165061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 39780803 - 39780850
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||| ||||||| ||| |||||||||||||| |||||||| |
|
|
| T |
39780803 |
atccccgtgagcgtagctcaattgctagggatattgcattttatatgc |
39780850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 40081875 - 40081922
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||| ||| |||||||| |
|
|
| T |
40081875 |
atccccgtgagcttagctcagttggtagagatattacatcttatatgc |
40081922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 302
Target Start/End: Original strand, 1469726 - 1469768
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
||||||| |||||||||||| ||| |||||||||||||||||| |
|
|
| T |
1469726 |
ccgtgagtttagctcagttggtagagatattgcatattatatg |
1469768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 302
Target Start/End: Original strand, 1729483 - 1729525
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||||||| | ||||||||||| |||||||||||||||| |
|
|
| T |
1729483 |
ccgtgagcttagtttagttgatagggttattgcatattatatg |
1729525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 257 - 303
Target Start/End: Original strand, 4067980 - 4068026
Alignment:
| Q |
257 |
tccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||||| |||||| | |||||||| ||||| |
|
|
| T |
4067980 |
tccccgtgagcttagctcagttggtagggacaatgcatattttatgc |
4068026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 265 - 303
Target Start/End: Original strand, 10404133 - 10404171
Alignment:
| Q |
265 |
agcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
10404133 |
agcttagctcagttggtaggaatattgcatattatatgc |
10404171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 256 - 302
Target Start/End: Original strand, 20719735 - 20719781
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||||||||||| || |||| |||||||||||||| ||||||| |
|
|
| T |
20719735 |
atccccgtgagcttagatctgttggtagggatattgcattttatatg |
20719781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 303
Target Start/End: Original strand, 30571164 - 30571198
Alignment:
| Q |
269 |
tagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30571164 |
tagctcagttggtagggatattgcatattatatgc |
30571198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 256 - 302
Target Start/End: Complemental strand, 31074200 - 31074154
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||| ||| ||||||| |
|
|
| T |
31074200 |
atccccgtgagcttaactcagttggtagggatattacattttatatg |
31074154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 255 - 301
Target Start/End: Complemental strand, 33433993 - 33433947
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
||||||||||| ||||||||||||| ||| |||||||||||||||| |
|
|
| T |
33433993 |
catccccgtgaacttagctcagttggtagaaatattgcatattatat |
33433947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 261 - 303
Target Start/End: Complemental strand, 39028101 - 39028059
Alignment:
| Q |
261 |
cgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||| |||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
39028101 |
cgtgagattagctcatttggtagggatattgcatattatatgc |
39028059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 261 - 303
Target Start/End: Complemental strand, 40276510 - 40276468
Alignment:
| Q |
261 |
cgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||| |||||||||||| |||| |||||||||||||||||| |
|
|
| T |
40276510 |
cgtgagtttagctcagttggtaggaatattgcatattatatgc |
40276468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 259 - 301
Target Start/End: Original strand, 42158882 - 42158924
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
42158882 |
cccgtgaacttagctcagtttgtagggatattgcatattatat |
42158924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 302
Target Start/End: Original strand, 42885830 - 42885872
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||||||||| ||||| ||| |||||||||||||||||| |
|
|
| T |
42885830 |
ccgtgagcttagctaagttggtagagatattgcatattatatg |
42885872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 250 - 295
Target Start/End: Original strand, 1060617 - 1060662
Alignment:
| Q |
250 |
agtttcatccccgtgagcttagctcagttgatagggatattgcata |
295 |
Q |
| |
|
||||| |||| |||| ||||||||||||||||||||||| |||||| |
|
|
| T |
1060617 |
agttttatcctcgtgggcttagctcagttgatagggataatgcata |
1060662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 262 - 303
Target Start/End: Original strand, 6119866 - 6119907
Alignment:
| Q |
262 |
gtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
6119866 |
gtgagcttagctcagttggaagggatattgcattttatatgc |
6119907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 254 - 303
Target Start/End: Complemental strand, 9688747 - 9688698
Alignment:
| Q |
254 |
tcatccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||| |||| ||| |||||||||||||||||| |
|
|
| T |
9688747 |
tcatccccgtgagcttagcttagtttgtagaaatattgcatattatatgc |
9688698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 255 - 303
Target Start/End: Complemental strand, 11815684 - 11815635
Alignment:
| Q |
255 |
catccccgtgagcttag-ctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| |||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
11815684 |
catccccgtgaacttacactcagttgaaagggatattgcatattatatgc |
11815635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 301
Target Start/End: Complemental strand, 12365531 - 12365486
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
|||||||||||| ||||| | ||||||| ||||||||||||||||| |
|
|
| T |
12365531 |
atccccgtgagcctagcttaattgatagagatattgcatattatat |
12365486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 262 - 295
Target Start/End: Original strand, 18928723 - 18928756
Alignment:
| Q |
262 |
gtgagcttagctcagttgatagggatattgcata |
295 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |
|
|
| T |
18928723 |
gtgagcttagctcagttggtagggatattgcata |
18928756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 262 - 303
Target Start/End: Original strand, 29045890 - 29045931
Alignment:
| Q |
262 |
gtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||| |||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
29045890 |
gtgagtttagttcagttggtagggatattgcatattatatgc |
29045931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 246 - 303
Target Start/End: Complemental strand, 35512039 - 35511982
Alignment:
| Q |
246 |
taatagtttcatccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||| ||| ||||||||||||||| |||||||| ||||||||| ||| |||||||| |
|
|
| T |
35512039 |
taataattttatccccgtgagcttaactcagttggtagggatatcacattttatatgc |
35511982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 266 - 303
Target Start/End: Complemental strand, 40098797 - 40098760
Alignment:
| Q |
266 |
gcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
40098797 |
gcttagctcagttgttaggaatattgcatattatatgc |
40098760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 260 - 301
Target Start/End: Complemental strand, 42842945 - 42842904
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||| ||||||||| |
|
|
| T |
42842945 |
ccgtgagcttagctcagttggtagagatattgtatattatat |
42842904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 259 - 303
Target Start/End: Original strand, 1670394 - 1670438
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||| ||||||| ||||||||| ||||||||||||| |
|
|
| T |
1670394 |
cccgtgagcttatatcagttggtagggatatggcatattatatgc |
1670438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 303
Target Start/End: Complemental strand, 13862358 - 13862318
Alignment:
| Q |
263 |
tgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||| | |||| ||||||||||||||||||||||||||| |
|
|
| T |
13862358 |
tgagctcaactcaattgatagggatattgcatattatatgc |
13862318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 259 - 295
Target Start/End: Complemental strand, 18049691 - 18049655
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcata |
295 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
18049691 |
cccgtgagcttagctcaattggtagggatattgcata |
18049655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 261 - 301
Target Start/End: Complemental strand, 20370192 - 20370152
Alignment:
| Q |
261 |
cgtgagcttagctcagttgatagggatattgcatattatat |
301 |
Q |
| |
|
||||||||||||||||||| |||||||| |||||| ||||| |
|
|
| T |
20370192 |
cgtgagcttagctcagttggtagggataatgcataatatat |
20370152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 259 - 303
Target Start/End: Original strand, 24477825 - 24477869
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||| |||||| ||||||| ||||||| |
|
|
| T |
24477825 |
cccgtgagcttagctcagttggtagggacgttgcataatatatgc |
24477869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 303
Target Start/End: Complemental strand, 36716924 - 36716884
Alignment:
| Q |
263 |
tgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||| ||||| || ||||||||||||||||||||||| |
|
|
| T |
36716924 |
tgagcttaactcagctggtagggatattgcatattatatgc |
36716884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #120
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 254 - 302
Target Start/End: Original strand, 39147722 - 39147770
Alignment:
| Q |
254 |
tcatccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
||||||||||||| ||| |||||||| |||| ||| ||||||||||||| |
|
|
| T |
39147722 |
tcatccccgtgagtttatctcagttggtaggaatactgcatattatatg |
39147770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #121
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 271 - 303
Target Start/End: Complemental strand, 42718879 - 42718847
Alignment:
| Q |
271 |
gctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
42718879 |
gctcagttggtagggatattgcatattatatgc |
42718847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0608 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: scaffold0608
Description:
Target: scaffold0608; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 255 - 303
Target Start/End: Original strand, 8962 - 9010
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8962 |
catccccgtgagcttagctcagttggtagggatattgcatattatatgc |
9010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0445 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: scaffold0445
Description:
Target: scaffold0445; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 255 - 303
Target Start/End: Complemental strand, 4088 - 4040
Alignment:
| Q |
255 |
catccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4088 |
catccccgtgagcttagctcagttggtagggatattgcatattatatgc |
4040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0707 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: scaffold0707
Description:
Target: scaffold0707; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 93 - 46
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
93 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
46 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0128 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: scaffold0128
Description:
Target: scaffold0128; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 17617 - 17664
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
17617 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
17664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121 (Bit Score: 44; Significance: 5e-16; HSPs: 2)
Name: scaffold0121
Description:
Target: scaffold0121; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 46523 - 46570
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
46523 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
46570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 11991 - 12038
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||| ||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11991 |
atcctcgtgaacttagctcagttggtagggatattgcatattatatgc |
12038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0088 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: scaffold0088
Description:
Target: scaffold0088; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 10899 - 10852
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10899 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
10852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 59780 - 59827
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
59780 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
59827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 266770 - 266723
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
266770 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
266723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1185 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 1)
Name: scaffold1185
Description:
Target: scaffold1185; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 254 - 303
Target Start/End: Complemental strand, 2448 - 2399
Alignment:
| Q |
254 |
tcatccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2448 |
tcatccccgtgagcgtagctcagttggtagggatattgcatattatatgc |
2399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0366 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: scaffold0366
Description:
Target: scaffold0366; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 259 - 303
Target Start/End: Complemental strand, 930 - 886
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
930 |
cccgtgagcttagctcagttggtagggatattgcatattatatgc |
886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 258 - 302
Target Start/End: Original strand, 5981 - 6025
Alignment:
| Q |
258 |
ccccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
5981 |
ccccgtgagcttagctcatttgatagggatattgcatattatatg |
6025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 259 - 303
Target Start/End: Complemental strand, 12331 - 12287
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
12331 |
cccgtgagcttagctcagttggtagggatattgcatattatatgc |
12287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1787 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold1787
Description:
Target: scaffold1787; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 397 - 444
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
397 |
atccccgtgaacttagctcaattgatagggatattgcatattatatgc |
444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0460 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: scaffold0460
Description:
Target: scaffold0460; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 12456 - 12503
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
12456 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgc |
12503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0460; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 266 - 303
Target Start/End: Complemental strand, 13266 - 13229
Alignment:
| Q |
266 |
gcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
13266 |
gcttagctcagttggtagggatattgcatattatatgc |
13229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0275 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0275
Description:
Target: scaffold0275; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 8818 - 8865
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
8818 |
atccccgtgagcttagctcagttggtagggatattgcattttatatgc |
8865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0100 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0100
Description:
Target: scaffold0100; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 299
Target Start/End: Original strand, 45881 - 45924
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattat |
299 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
45881 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
45924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0031
Description:
Target: scaffold0031; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 259 - 302
Target Start/End: Complemental strand, 50071 - 50028
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
50071 |
cccgtgagcttaactcagttgatagggatattgcatattatatg |
50028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 112105 - 112152
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
112105 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgc |
112152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 8898 - 8851
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
8898 |
atccccgtgagcttagctcagttggtagggatattgcatattttatgc |
8851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0288 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0288
Description:
Target: scaffold0288; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 258 - 303
Target Start/End: Original strand, 21263 - 21308
Alignment:
| Q |
258 |
ccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
21263 |
ccccgtgagcttagcttagttggtagggatattgcatattatatgc |
21308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0690 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: scaffold0690
Description:
Target: scaffold0690; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 259 - 303
Target Start/End: Original strand, 3666 - 3710
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
3666 |
cccgtgagcttaactcagttggtagggatattgcatattatatgc |
3710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0025 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: scaffold0025
Description:
Target: scaffold0025; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 262 - 302
Target Start/End: Complemental strand, 65854 - 65814
Alignment:
| Q |
262 |
gtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
65854 |
gtgagcttagctcagttggtagggatattgcatattatatg |
65814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0157 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0157
Description:
Target: scaffold0157; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 15761 - 15808
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||| |||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
15761 |
atcctcgtgagcttatctcagttggtagggatattgcatattatatgc |
15808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038 (Bit Score: 36; Significance: 0.00000000003; HSPs: 2)
Name: scaffold0038
Description:
Target: scaffold0038; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 37487 - 37440
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||| |||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
37487 |
atcctcgtgagcttaactcagttggtagggatattgcatattatatgc |
37440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 259 - 303
Target Start/End: Original strand, 23361 - 23405
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||| |||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
23361 |
cccgtgaacttaactcagttggtagggatattgcatattatatgc |
23405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1372 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold1372
Description:
Target: scaffold1372; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 266 - 303
Target Start/End: Original strand, 1871 - 1908
Alignment:
| Q |
266 |
gcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1871 |
gcttagctcagttggtagggatattgcatattatatgc |
1908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0864 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0864
Description:
Target: scaffold0864; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 262 - 303
Target Start/End: Complemental strand, 3660 - 3619
Alignment:
| Q |
262 |
gtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
3660 |
gtgagcttagctcagttggtagggatatttcatattatatgc |
3619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0294 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold0294
Description:
Target: scaffold0294; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 17334 - 17287
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||| ||| |||| |
|
|
| T |
17334 |
atccccgtgaacttaactcagttgatagggatattgcattttacatgc |
17287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187 (Bit Score: 32; Significance: 0.000000007; HSPs: 2)
Name: scaffold0187
Description:
Target: scaffold0187; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 268 - 303
Target Start/End: Complemental strand, 11181 - 11146
Alignment:
| Q |
268 |
ttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11181 |
ttagctcagttggtagggatattgcatattatatgc |
11146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 268 - 303
Target Start/End: Complemental strand, 21509 - 21474
Alignment:
| Q |
268 |
ttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
21509 |
ttagctcagttggtagggatattgcatattatatgc |
21474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0113 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold0113
Description:
Target: scaffold0113; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 260 - 303
Target Start/End: Complemental strand, 37117 - 37074
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||| ||||||||||| | |||||||||||||||||| |
|
|
| T |
37117 |
ccgtgagcttaactcagttgataagaatattgcatattatatgc |
37074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 28003 - 27956
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||| |||||||||||||| |||| |||||||||||||| |||||||| |
|
|
| T |
28003 |
atcctcgtgagcttagctcggttggtagggatattgcattttatatgc |
27956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0010 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold0010
Description:
Target: scaffold0010; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 299
Target Start/End: Complemental strand, 236428 - 236385
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattat |
299 |
Q |
| |
|
||||||||||| |||| ||||||| ||||||||||||||||||| |
|
|
| T |
236428 |
atccccgtgagattagttcagttggtagggatattgcatattat |
236385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 315646 - 315693
Alignment:
| Q |
256 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||| ||||||||||||| || ||||||||||| |||||||| |
|
|
| T |
315646 |
atccccgtgaacttagctcagttggtaaggatattgcattttatatgc |
315693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0330 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0330
Description:
Target: scaffold0330; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 302
Target Start/End: Original strand, 6769 - 6811
Alignment:
| Q |
260 |
ccgtgagcttagctcagttgatagggatattgcatattatatg |
302 |
Q |
| |
|
|||||| |||| |||||||| |||||||||||||||||||||| |
|
|
| T |
6769 |
ccgtgaacttaactcagttggtagggatattgcatattatatg |
6811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1709 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold1709
Description:
Target: scaffold1709; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 303
Target Start/End: Original strand, 175 - 215
Alignment:
| Q |
263 |
tgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
175 |
tgagcttagctcagttggtatagatattgcatattatatgc |
215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1331 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold1331
Description:
Target: scaffold1331; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 303
Target Start/End: Complemental strand, 146 - 106
Alignment:
| Q |
263 |
tgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
146 |
tgagcttagctcagttggtatagatattgcatattatatgc |
106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0394 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0394
Description:
Target: scaffold0394; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 259 - 303
Target Start/End: Original strand, 1262 - 1306
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||| |||||||| |||| |||||| ||||||||||| |
|
|
| T |
1262 |
cccgtgagcttaactcagttggtaggaatattgtatattatatgc |
1306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0254 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0254
Description:
Target: scaffold0254; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 259 - 303
Target Start/End: Original strand, 1317 - 1361
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||| |||||||| |||| |||||| ||||||||||| |
|
|
| T |
1317 |
cccgtgagcttaactcagttggtaggaatattgtatattatatgc |
1361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0063 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0063
Description:
Target: scaffold0063; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 259 - 303
Target Start/End: Original strand, 56323 - 56367
Alignment:
| Q |
259 |
cccgtgagcttagctcagttgatagggatattgcatattatatgc |
303 |
Q |
| |
|
|||||||||||| |||| ||| |||||||||||||||||||||| |
|
|
| T |
56323 |
cccgtgagcttaactcaattggcagggatattgcatattatatgc |
56367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0045 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0045
Description:
Target: scaffold0045; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 103 - 179
Target Start/End: Complemental strand, 44531 - 44455
Alignment:
| Q |
103 |
gctaggattagttgaccgttagaaaatcaatggcttgatctctcatcataaatgagcactaattgagaaagttgaca |
179 |
Q |
| |
|
|||| ||||| |||||||||| ||||| ||||| ||| || | |||||||||||| |||||||||||||||||| |
|
|
| T |
44531 |
gctaagattatttgaccgttacaaaattaatggattgtcttcacctcataaatgagcgataattgagaaagttgaca |
44455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University