View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1916_high_18 (Length: 288)

Name: NF1916_high_18
Description: NF1916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1916_high_18
NF1916_high_18
[»] chr4 (2 HSPs)
chr4 (172-288)||(22484694-22484811)
chr4 (76-127)||(22484600-22484649)


Alignment Details
Target: chr4 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 172 - 288
Target Start/End: Original strand, 22484694 - 22484811
Alignment:
172 tgtgtctctgagacattgtggggcc-tcattcgcgtggatgcaactattttgtggaccccacttgtcgtttttcttgttgtgtgtcataggggtccccaa 270  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
22484694 tgtgtctctgagacattgtggggccctcattcgcgtggatgcaactattttgtggaccccacttgtcgtttttcttgttgtgtgtcatacgggtccccaa 22484793  T
271 gcatccaccatttctttc 288  Q
    ||||||||||||||||||    
22484794 gcatccaccatttctttc 22484811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 76 - 127
Target Start/End: Original strand, 22484600 - 22484649
Alignment:
76 ttcgagtcacttctaaattctgtactgcaacggtttttctttcatattgaag 127  Q
    |||||||||||||||||||||||||||||||||  |||||||||||||||||    
22484600 ttcgagtcacttctaaattctgtactgcaacgg--tttctttcatattgaag 22484649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University