View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1916_high_25 (Length: 251)
Name: NF1916_high_25
Description: NF1916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1916_high_25 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 89 - 204
Target Start/End: Complemental strand, 17247906 - 17247791
Alignment:
| Q |
89 |
aaatccagaagaccaactaccttagctgctttctcatggtttcttgggtggtggtctttctctctggattaggttgcttcgccaccgtgctctattttct |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
17247906 |
aaatccagaagaccaactaccttagctgctttctcatggtttcttgggtggtggtctttctctctggattatgttgcttcttcaccgtgctctattttct |
17247807 |
T |
 |
| Q |
189 |
tttctcttcattagtt |
204 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
17247806 |
tttctcttcattagtt |
17247791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 201 - 236
Target Start/End: Original strand, 16892994 - 16893029
Alignment:
| Q |
201 |
agttgaggaagaggacagtgatgaagccatcacatc |
236 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |
|
|
| T |
16892994 |
agttgaggaagaggacaatgatgaagccatcacatc |
16893029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University