View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1916_high_25 (Length: 251)

Name: NF1916_high_25
Description: NF1916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1916_high_25
NF1916_high_25
[»] chr6 (1 HSPs)
chr6 (89-204)||(17247791-17247906)
[»] chr3 (1 HSPs)
chr3 (201-236)||(16892994-16893029)


Alignment Details
Target: chr6 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 89 - 204
Target Start/End: Complemental strand, 17247906 - 17247791
Alignment:
89 aaatccagaagaccaactaccttagctgctttctcatggtttcttgggtggtggtctttctctctggattaggttgcttcgccaccgtgctctattttct 188  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||  ||||||||||||||||||    
17247906 aaatccagaagaccaactaccttagctgctttctcatggtttcttgggtggtggtctttctctctggattatgttgcttcttcaccgtgctctattttct 17247807  T
189 tttctcttcattagtt 204  Q
    ||||||||||||||||    
17247806 tttctcttcattagtt 17247791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 201 - 236
Target Start/End: Original strand, 16892994 - 16893029
Alignment:
201 agttgaggaagaggacagtgatgaagccatcacatc 236  Q
    ||||||||||||||||| ||||||||||||||||||    
16892994 agttgaggaagaggacaatgatgaagccatcacatc 16893029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University