View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1916_low_20 (Length: 288)
Name: NF1916_low_20
Description: NF1916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1916_low_20 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 172 - 288
Target Start/End: Original strand, 22484694 - 22484811
Alignment:
| Q |
172 |
tgtgtctctgagacattgtggggcc-tcattcgcgtggatgcaactattttgtggaccccacttgtcgtttttcttgttgtgtgtcataggggtccccaa |
270 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
22484694 |
tgtgtctctgagacattgtggggccctcattcgcgtggatgcaactattttgtggaccccacttgtcgtttttcttgttgtgtgtcatacgggtccccaa |
22484793 |
T |
|
| Q |
271 |
gcatccaccatttctttc |
288 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
22484794 |
gcatccaccatttctttc |
22484811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 76 - 127
Target Start/End: Original strand, 22484600 - 22484649
Alignment:
| Q |
76 |
ttcgagtcacttctaaattctgtactgcaacggtttttctttcatattgaag |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
22484600 |
ttcgagtcacttctaaattctgtactgcaacgg--tttctttcatattgaag |
22484649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University