View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1916_low_29 (Length: 243)
Name: NF1916_low_29
Description: NF1916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1916_low_29 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 32 - 226
Target Start/End: Original strand, 22484912 - 22485102
Alignment:
| Q |
32 |
aataataaataaatgtttctttaggtgagtaagatttttgtgactcacttatgctagaatactagggaagggaaagctcgcatacatacatagcatctac |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
22484912 |
aataataaataaatgtttctttaggtgagtaagatttttgtgactcacttatgctagaatactagggaagggaaagctc----acatacatagcatctac |
22485007 |
T |
|
| Q |
132 |
agtctactagtagggatgtcgatttgggccccaacataatcttaannnnnnnnggtatggacggtaatcataatcgatattctagggtttacaac |
226 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| ||||| || |||||||||||| |||||||||||||||||| |
|
|
| T |
22485008 |
agtctactagtggggatgtcgatttgggccccaacataatcttaattttttttagtatgaaccataatcataatcggtattctagggtttacaac |
22485102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University