View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19170_low_2 (Length: 371)
Name: NF19170_low_2
Description: NF19170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19170_low_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 243; Significance: 1e-134; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 243; E-Value: 1e-134
Query Start/End: Original strand, 105 - 359
Target Start/End: Original strand, 4912824 - 4913078
Alignment:
| Q |
105 |
atccggtggatgaaataataatactaagatgtgtattttcttacctcactggcatagatagcagtggtgtttgagttctatctagattgggagtttatac |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4912824 |
atccggtggatgaaataataatactaagatgtgtattttcttacctcattggcatagatagcagtggtgtttgagttctatctagattgggagtttatac |
4912923 |
T |
 |
| Q |
205 |
atttgtgttttgcataagctcctaattaattatttgtggtgtggttcgatcaaagattgttgatgatcattcaagcttcttatattttggttggtattgg |
304 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4912924 |
atttttgttttgcataagctcctaattaattatttgtggtgtggttcgatcaaagattgttgatgatcattgaagcttcttatattttggttggtattgg |
4913023 |
T |
 |
| Q |
305 |
taggaggtttgaggttcatcgatcggctacttttgtggtttttggactcttgttc |
359 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4913024 |
taggaggtttgaggttcatcgatcggctacttttgtggtttttggactcttgttc |
4913078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 20 - 79
Target Start/End: Original strand, 4912765 - 4912824
Alignment:
| Q |
20 |
tatttatttatttattgcagaaagaaacaggatacaacttgaccgaaaatgatcttgtaa |
79 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
4912765 |
tatttatttatttattgcagaaagaaacaggatacaacttgaccgaaaatgatattgtaa |
4912824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 45 - 107
Target Start/End: Original strand, 4918415 - 4918477
Alignment:
| Q |
45 |
aacaggatacaacttgaccgaaaatgatcttgtaaaaagcgtacacgctgctgtattgagatc |
107 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
4918415 |
aacaggatacaacttgaccaaaaatgatcttgtaaaaagcgtacaggcggctgtattgagatc |
4918477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University