View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19170_low_5 (Length: 267)
Name: NF19170_low_5
Description: NF19170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19170_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 13 - 250
Target Start/End: Complemental strand, 16818520 - 16818286
Alignment:
| Q |
13 |
aatatcagggtcgggcctgaacactatgttttactacgaaaacttcataaaaaagtcctcaaataaggagcataaaagtactcaagtattaaaataccat |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
16818520 |
aatatcagggtcgggcctgaacactatgttttactacgaaaacttcataaaaaagtcctcaaa---ggagcataaaagtactcaagtattaaaataccat |
16818424 |
T |
|
| Q |
113 |
aacatcatgaacataaaactattatggacgaatagaagagagaactacatcttgaagagagctatctctttgcatagcagctttgaattcatcaaatgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16818423 |
aacatcatgaacataaaactattatggacgaatagaagagagaactacatcttgaagagagctatctctttgcatagcagctttgaattcatcaaatgta |
16818324 |
T |
|
| Q |
213 |
acttttccatcattattagcatccattaagtcaaaaat |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16818323 |
acttttccatcattattagcatccattaagtcaaaaat |
16818286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University