View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19170_low_6 (Length: 242)
Name: NF19170_low_6
Description: NF19170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19170_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 16 - 229
Target Start/End: Original strand, 44548888 - 44549094
Alignment:
| Q |
16 |
atgaaatatgcggacaaggagcgagcagaccgatttttattgttacataatggttgtcatagatgacacatttatcacgttttattagaacatatatcct |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44548888 |
atgaaatatgcggacaaggagcgagcagaccgatttttattgttacat-------gtcatagatgacacatttatcacgttttattagaacatatatcct |
44548980 |
T |
 |
| Q |
116 |
tctttttaaaagagttatagcatagatatttgatgaggagtatgaannnnnnnacttttaaggaagataggagtatgatatctaatctatgcatagatat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44548981 |
tctttttaaaagagttatagcatagatacttgatgaggagtatgaatttttttatttttaaggaagataggagtatgatatctaatctatgcatagatat |
44549080 |
T |
 |
| Q |
216 |
tcttagataatatt |
229 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
44549081 |
tcttagataatatt |
44549094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University