View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19171_high_14 (Length: 341)
Name: NF19171_high_14
Description: NF19171
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19171_high_14 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 138; Significance: 4e-72; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 19 - 176
Target Start/End: Original strand, 7869236 - 7869393
Alignment:
| Q |
19 |
cctaatcaagttttctagctacagaggggaagaatctaaaatatgaaaccctagtttcttcttttggatcaaggaaattggcacatccattgatacttga |
118 |
Q |
| |
|
||||||||||||||||| ||||| | |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
7869236 |
cctaatcaagttttctaactacacaagggaagaatctaaaatatgaaaccctagtttcttctttcggatcaaggaaattggcacatccattgatacttga |
7869335 |
T |
|
| Q |
119 |
tggcagaaattgatggaaacctcccaaccttttttcacccaacaaagaattttgaatg |
176 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7869336 |
tggcagaaagtgatggaaacctcccaaccttttttcacccaacaaagaattttgaatg |
7869393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 244 - 335
Target Start/End: Original strand, 7869461 - 7869552
Alignment:
| Q |
244 |
agattattgccattatgaggaagcttaagaacatggaattgaaccaaggtgtgtgctctaatttgtagatatactacaaattatcattggct |
335 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7869461 |
agattattgccattatgaggaagcttaagaacatggaattgaaccaaggtgtgtgctctaatttgtggatatactacaaattatcattggct |
7869552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 37 - 161
Target Start/End: Complemental strand, 7863028 - 7862906
Alignment:
| Q |
37 |
ctacagaggggaagaatctaaaatatgaaaccctagtttcttcttttggatcaaggaaattggcacatccattgatacttgatggcagaaattgatggaa |
136 |
Q |
| |
|
|||||||||| ||||||||||| ||||| ||||| |||||||| |||||||| ||||||||| ||| | ||||| |||| |||||||||||||| |
|
|
| T |
7863028 |
ctacagaggg--agaatctaaaacatgaattcctagattcttcttcaaactcaaggaagttggcacattcatgg-tacttcatgggagaaattgatggaa |
7862932 |
T |
|
| Q |
137 |
acctcccaacct-tttttcacccaac |
161 |
Q |
| |
|
||| ||||| || ||||||| ||||| |
|
|
| T |
7862931 |
accacccaatctctttttcaaccaac |
7862906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University