View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19172_high_3 (Length: 334)
Name: NF19172_high_3
Description: NF19172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19172_high_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 12 - 319
Target Start/End: Complemental strand, 46796032 - 46795737
Alignment:
| Q |
12 |
atgaaaattgacaaaacaaaaagcttagtaagtaatatggggaaaagcattggagttagagnnnnnnnnnnnnnncttatatttggcaaataaaaattga |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
46796032 |
atgaaaattgacaaaacaaaaagcttagtaagtaatatggggaaa-gcattggagttagagacacacacacacatcttatatttggcaaataaaaattga |
46795934 |
T |
|
| Q |
112 |
agctcggcggttatgtctgggtgaagatggggaatcaagaaaggaaacatgaggtcatatggcatggcaccaccggtggtctactagaagtgattggggg |
211 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
46795933 |
agctcggcggcta------ggtgaagatggggaatcaagaaaggaaacatgaggtcatatggca-----ccaccggtggtctactagaagtgattggggg |
46795845 |
T |
|
| Q |
212 |
tctaggcggttgattggcagtcatctgctgctgctgctgcaccgtagatgggtccatagaagcaaccaactgcactgcacttgagataataataacatat |
311 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46795844 |
tctaggcggttgattgacagtcatctgctgctgctgctgcaccgtagatgggtccatagaagcaaccaactgcactgcacttgagataataataacatat |
46795745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University