View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19172_low_4 (Length: 263)
Name: NF19172_low_4
Description: NF19172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19172_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 19 - 97
Target Start/End: Original strand, 40172621 - 40172699
Alignment:
| Q |
19 |
ggtatgagatatagcttttcaaatttccaaactcaggtttttctatcatatcgtttatgcagttatgcctgtggtttag |
97 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
40172621 |
ggtatgagatatagcttttcaaacttccaaactcaggtttttctatcatatcatttatgcagttatgcctgtggtttag |
40172699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 187 - 263
Target Start/End: Original strand, 40172833 - 40172909
Alignment:
| Q |
187 |
agaaatttaaaaggccatctatggactacatggagaagatacaggaaaacatctatgctagcatgcgggcaatgctt |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||| ||| ||||||||||||||||||||||| |
|
|
| T |
40172833 |
agaaatttaaaaggccatctatggactacatggagaagatacagaaaaagatcaatgctagcatgcgggcaatgctt |
40172909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University