View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19173_high_9 (Length: 251)
Name: NF19173_high_9
Description: NF19173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19173_high_9 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 124 - 251
Target Start/End: Complemental strand, 28465877 - 28465750
Alignment:
| Q |
124 |
atgagataggtttgttttcatattaatattaatatactcctagtgtttagttttttcccctaaacttagcaatcatagaagttgtgnnnnnnntgcataa |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
28465877 |
atgagataggtttgttttcatattaatattaatatactcctagtgtttagttttttcccctaaacttagcaatcatagaagttgtgaaaaaaatgcataa |
28465778 |
T |
|
| Q |
224 |
agcatgggtaagaatgagatgcatgaca |
251 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
28465777 |
agcatgggtaagaatgagatgcatgaca |
28465750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 16 - 49
Target Start/End: Complemental strand, 28465985 - 28465952
Alignment:
| Q |
16 |
atagtagtaattttttggacttatagtttgtctc |
49 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
28465985 |
atagtagtaattttttggacttatagtttgtctc |
28465952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University