View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19173_low_10 (Length: 253)
Name: NF19173_low_10
Description: NF19173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19173_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 106 - 228
Target Start/End: Original strand, 18716791 - 18716913
Alignment:
| Q |
106 |
gggttttataaaagcatataagttaggagagttgtaatataattgatggtttggtattggaataagcccgctgtttcatttggaattattcgggtgatga |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18716791 |
gggttttataaaagcatataagttaggagagttgtaatataattgatggtttggtattggaataagcccgctgtttcatttggaattattcgggtgatga |
18716890 |
T |
 |
| Q |
206 |
ttgctagagatatgtccaacaaa |
228 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
18716891 |
ttgctagagatatgtccaacaaa |
18716913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University