View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19173_low_11 (Length: 251)

Name: NF19173_low_11
Description: NF19173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19173_low_11
NF19173_low_11
[»] chr7 (2 HSPs)
chr7 (124-251)||(28465750-28465877)
chr7 (16-49)||(28465952-28465985)


Alignment Details
Target: chr7 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 124 - 251
Target Start/End: Complemental strand, 28465877 - 28465750
Alignment:
124 atgagataggtttgttttcatattaatattaatatactcctagtgtttagttttttcccctaaacttagcaatcatagaagttgtgnnnnnnntgcataa 223  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||    
28465877 atgagataggtttgttttcatattaatattaatatactcctagtgtttagttttttcccctaaacttagcaatcatagaagttgtgaaaaaaatgcataa 28465778  T
224 agcatgggtaagaatgagatgcatgaca 251  Q
    ||||||||||||||||||||||||||||    
28465777 agcatgggtaagaatgagatgcatgaca 28465750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 16 - 49
Target Start/End: Complemental strand, 28465985 - 28465952
Alignment:
16 atagtagtaattttttggacttatagtttgtctc 49  Q
    ||||||||||||||||||||||||||||||||||    
28465985 atagtagtaattttttggacttatagtttgtctc 28465952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University