View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19173_low_12 (Length: 239)
Name: NF19173_low_12
Description: NF19173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19173_low_12 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 17 - 239
Target Start/End: Original strand, 28465392 - 28465614
Alignment:
| Q |
17 |
gttatgaccatatttgttggtctttgattataatcaggtcttgattaaatttaaaatgattctatatttacaactgaatatacaaattcaatgtattgaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28465392 |
gttatgaccatatttgttggtctttgattataatcaggtcttgattaaatttaaaatgattctatatttacaactgaatatacaaattcaatgtattgaa |
28465491 |
T |
 |
| Q |
117 |
ttgcgatgaaagaaatcaacggtaacacacaacaccaagtttgttcttcttatttaccctaaactccacttttttctaataaccatggcaaacagattct |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28465492 |
ttgcgatgaaagaaatcaacggtaacacacaacaccaagtttgttcttcttatttaccctaaactccacttttttctaataaccatggcaaacagattct |
28465591 |
T |
 |
| Q |
217 |
ctaggatcctccaaatcccaccc |
239 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
28465592 |
ctaggatcctccaaatcccaccc |
28465614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University