View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19173_low_5 (Length: 359)
Name: NF19173_low_5
Description: NF19173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19173_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 86 - 345
Target Start/End: Complemental strand, 35916549 - 35916290
Alignment:
| Q |
86 |
gaaacaacatcaatccctttgtgggaaacagctcaacttccacttccagaagactgcatcacggaacatgcaacagcttgagcccaatgtcttaacttgg |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35916549 |
gaaacaacatcaatccctttgtgggaaacagctcaacttccacttccagaagactgcatcacggaacatgcaacagcttgagcccaatgtcttaatttgg |
35916450 |
T |
 |
| Q |
186 |
tcttcaccaattcaggatcatcccctacattgcacaaagatgcaaacccgcaacctcgtcagcaaaactatacatgcatttaatctattaatttgtataa |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
35916449 |
tcttcaccaattcaggatcatcccctacattgcacaaagatgcaaacccgcaacctcgtcagcaaaactatacatgcatttaatatattaatttgtataa |
35916350 |
T |
 |
| Q |
286 |
ttttttgccaataatgtataagacaaacacattgagatgttaaaaaataggtatatatat |
345 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35916349 |
ttttttgccaataatgtataagacaaacacattgagatgttaaaaaataggtatatatat |
35916290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University