View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19174_high_7 (Length: 304)
Name: NF19174_high_7
Description: NF19174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19174_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 66; Significance: 3e-29; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 150 - 287
Target Start/End: Original strand, 45512679 - 45512816
Alignment:
| Q |
150 |
acttgactggaaattatttcagtttgagtccaattcctatgttcatcggttccatgggacgtcttgagtatctatctctctctaatgcggcttttagcgg |
249 |
Q |
| |
|
||||| |||||||| |||||||| ||||||||||||||||||| | |||||||||||||| ||||||||||| ||||| ||| |||| | ||||||| |
|
|
| T |
45512679 |
acttgtctggaaataatttcagtgggagtccaattcctatgttcttgggttccatgggacgccttgagtatctctctctgtctcatgctcgtcttagcgg |
45512778 |
T |
 |
| Q |
250 |
gaggattcccaacaatcttggaaatctcaagaatctac |
287 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||| |||| |
|
|
| T |
45512779 |
gaggattcccaacagtctcagaaatctcaagaacctac |
45512816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 1 - 69
Target Start/End: Original strand, 45512420 - 45512488
Alignment:
| Q |
1 |
catgattcaccaaacaagctttctacatggaaaggcactcactgttgccaatgggaaagcattggttgt |
69 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
45512420 |
catgattcaccaaacaagctttcatcatggaaaggcactcactgttgccaatgggaaggcattggttgt |
45512488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 113 - 157
Target Start/End: Original strand, 45512627 - 45512671
Alignment:
| Q |
113 |
gctccaaatctgagctcatctttgttgcacttggaatacttgact |
157 |
Q |
| |
|
||||||||| ||||||||||||||||||| |||||| |||||||| |
|
|
| T |
45512627 |
gctccaaatgtgagctcatctttgttgcaattggaacacttgact |
45512671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 63; Significance: 2e-27; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 150 - 232
Target Start/End: Complemental strand, 22848880 - 22848798
Alignment:
| Q |
150 |
acttgactggaaattatttcagtttgagtccaattcctatgttcatcggttccatgggacgtcttgagtatctatctctctct |
232 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||||||||| | |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
22848880 |
acttgactggaaatgatttcaatttgagtccaattcctatgttcgtaggttccatgggacgtcttgagtatctctctctctct |
22848798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 224 - 288
Target Start/End: Complemental strand, 22848770 - 22848706
Alignment:
| Q |
224 |
tctctctctaatgcggcttttagcgggaggattcccaacaatcttggaaatctcaagaatctaca |
288 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
22848770 |
tctctctctaatgcggctttcaaagggaggattcccaacaatcttggaaatctcaagaatttaca |
22848706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 117 - 157
Target Start/End: Complemental strand, 22848928 - 22848888
Alignment:
| Q |
117 |
caaatctgagctcatctttgttgcacttggaatacttgact |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22848928 |
caaatctgagctcatctttgttgcacttggaatacttgact |
22848888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University