View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19175_high_113 (Length: 251)
Name: NF19175_high_113
Description: NF19175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19175_high_113 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 137 - 235
Target Start/End: Complemental strand, 36259817 - 36259719
Alignment:
| Q |
137 |
taaaaattacaaatagttgaatagtagtgcagtgccacattgtgggttttaacgtaaaatcactatgggtagggtaaagcatattacttgaaataaatc |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
36259817 |
taaaaattacaaatagttgaatagtagtgcagtgccacattgtgggttttaacgtaaaatcactataggtagggtaaagcatattacttgaaataaatc |
36259719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 73 - 123
Target Start/End: Complemental strand, 36259994 - 36259944
Alignment:
| Q |
73 |
tacatcaattctatagaattatggcatttgagataagagagcttcaatttt |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36259994 |
tacatcaattctatagaattatggcatttgagataagagagcttcaatttt |
36259944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University