View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19175_high_123 (Length: 247)
Name: NF19175_high_123
Description: NF19175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19175_high_123 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 37 - 247
Target Start/End: Complemental strand, 32261668 - 32261459
Alignment:
| Q |
37 |
gttcatgtggtgtacaatacttgaaaatctttcaaaactttaaattacaatcaaaattattgtatttaaatagaagttcaattcgtctaagtaattatat |
136 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |||||||||||| |||| | ||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32261668 |
gttcatgtggtgtaaaatacttgaaaatctttcaaaattttaaattacaaccaaagtcatt-tatttaaatagaagttcaattcgtctaagtaattatat |
32261570 |
T |
 |
| Q |
137 |
ttgagagttgagacaatgacctgatcagtgttaataaaacaaaaacagtataaaaagaatatatattgaattttgaggtactaaaatttatttttattgt |
236 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
32261569 |
ttgagagttgagacaatgacctgatcaatgttaataaaacaaaaacagtataaaaagaatatatattaaattttgaggtactaatatttatttttattgt |
32261470 |
T |
 |
| Q |
237 |
ctatcttttgc |
247 |
Q |
| |
|
||||||||||| |
|
|
| T |
32261469 |
ctatcttttgc |
32261459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University