View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19175_high_128 (Length: 240)

Name: NF19175_high_128
Description: NF19175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19175_high_128
NF19175_high_128
[»] chr4 (1 HSPs)
chr4 (9-223)||(9456506-9456720)


Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 9 - 223
Target Start/End: Complemental strand, 9456720 - 9456506
Alignment:
9 caagaatataaatatcatattgaaagtttgttnnnnnnnngttgtacgtttaaaaataacttggatgtaagaaaaccacaagaacaattgcaccaatgaa 108  Q
    |||||| |||||||||||||||||||||||||        ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
9456720 caagaaaataaatatcatattgaaagtttgttaaaaaaaagttgtacatttaaaaataacttggatgtaagaaaaccacaagaacaattgcaccaatgaa 9456621  T
109 tggtgacaataacacaaattcataaagggttgttaattaaactaggaagcttcgatggcaacataacaccacttcaatggcaatataaattcatgttcta 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||    
9456620 tggtgacaataacacaaattcataaagggttgttaattaaactaggaagcttcaatggcaacataacaccacttcaatggcaacataaattcatgttcta 9456521  T
209 caaaatacgatcatt 223  Q
    |||||||||||||||    
9456520 caaaatacgatcatt 9456506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University