View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19175_high_130 (Length: 238)
Name: NF19175_high_130
Description: NF19175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19175_high_130 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 18 - 238
Target Start/End: Original strand, 52510805 - 52511029
Alignment:
| Q |
18 |
ccccttatgtctaactcaacaattttagttcctta----gttttgttgattttggaaattaaactcttatttcttcccttacgttgatgtgacacacttt |
113 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52510805 |
ccccttatgtctaactcaataattttagttccttaattagttttgttgattttggaaattaaactcttatttcttcccttacgttgatgtgacacacttt |
52510904 |
T |
 |
| Q |
114 |
aatattgatagttgataatttaattaaagtatatactcctgtttatgaattattttatttttcaattctagacacatcttatgtttgactgacttattaa |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
52510905 |
aatattgatagttgataatttaattaaagtatatactcctgtttatgaattattttatttttcaattctagacacatcttatgcttgactgacttcttaa |
52511004 |
T |
 |
| Q |
214 |
tttatatatattttatttgatttct |
238 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
52511005 |
tttatatatattttatttgatttct |
52511029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University