View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19175_high_139 (Length: 216)
Name: NF19175_high_139
Description: NF19175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19175_high_139 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 18 - 198
Target Start/End: Original strand, 54276129 - 54276309
Alignment:
| Q |
18 |
gaataaaaatgtccagaaatattgagatattttcttttgtgaaaagtgtggaggcaaaatgtatggggcatggggacttatttggggacgtagagtagaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
54276129 |
gaataaaaatgtccagaaatattgagatattttcttttgtgaaaagtgtggaggcaaaatgtatggggcatggggacttatttggggacgtagagtaaaa |
54276228 |
T |
|
| Q |
118 |
ttttcctttattatttcttctggaacatttgctatttgcaaggagatgcacatagaggtggaaaatgtgtcttgtgtttag |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54276229 |
ttttcctttattatttcttctggaacatttgctatttgcaaggagatgcacatagaggtggaaaatgtgtcttgtgtttag |
54276309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University