View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19175_high_141 (Length: 208)
Name: NF19175_high_141
Description: NF19175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19175_high_141 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 1 - 190
Target Start/End: Original strand, 48203012 - 48203201
Alignment:
| Q |
1 |
tgggtctggttccgattttcttcggaatcgaaaactacatatagttgtgattatggcaatggttgcagcaaaacttgctgcaaacaatgagaaatgaaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48203012 |
tgggtctggttccgattttcttcggaatcgaaaactacatatagttgtgattatggcaatggttgcagcaaaacttgctgcaaacaatgagaaatgaaga |
48203111 |
T |
 |
| Q |
101 |
aatgggtgtattaatgagatgttgccaagaggtactctccttcccatgacaaacaaacattcaaatttgtgtgtaatgtgtattattgtg |
190 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
48203112 |
aatgggtgtattaatgagatgttaccaagaggtactctccttcccatgacaaacaaacattcaaatatgtgtgtaatgtgtattattgtg |
48203201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 18 - 61
Target Start/End: Complemental strand, 4083068 - 4083025
Alignment:
| Q |
18 |
ttcttcggaatcgaaaactacatatagttgtgattatggcaatg |
61 |
Q |
| |
|
||||||| ||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
4083068 |
ttcttcgaaatcgaacactacatagagttgtgattatggcaatg |
4083025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University